Contact experts in Sequencing to get answers
1,727 views 575 posts
Questions related to Sequencing
Any linker sequence should add between the myc-tag and the insert sequence? Thank you very much!
02 June 2017 7,284 2 View
Currently, I am working in crec of uf, in florida. Our sanger sequencing results are not so good very often. So we want to change the company. So if you get better sanger sequencing company...
31 May 2017 1,069 2 View
I am trying to produce RNAs ranging from 17 to 60 nt to for a gel shift experiment. For the longer ones, I've already had decent success using two partially-overlapping oligos (filled in with...
30 May 2017 6,526 4 View
Hello, I have some .FASTQ files from Illumina solexa sequencing. Now I want to analyse the OTUs, generate heat map and other relevant information about the microbial biodiversity. I am trying it...
29 May 2017 8,112 1 View
Suppose this is the designed antisense oligo for Nicotiana tabacum (NtVI A3.6 722L20 5’CTATCTTCTTCTGCACTTCG 3’). I want to check on target and is their any off-target site.When i am doing...
26 May 2017 3,383 2 View
I have many sequences from the environment to do function gene but I am not experienced analysis sequence to get the phylogenetic tree, please could someone help me step by step how I can do this?...
24 May 2017 8,727 4 View
Is there any specific sequence different from TATA for the TATA box in fungi?i had about 61 base pairs deletion upstream and 462 base pairs deletion downstream of the first transcription ATG but...
23 May 2017 10,112 3 View
i have ITS and Rbcl sequences and i want to analyse for combination of markers. can anyone suggest me how to do
21 May 2017 4,793 1 View
For instance, how we generate an accurate results of detecting occlusion in a sequence of images in real time ?
20 May 2017 5,697 1 View
The m6A (N6-Methyladenosine) modification on RNA has a RRACH motif, so what about the 6mA (N6-Methyladenine) modification on DNA? Is there any specific sequence found though mapping its...
19 May 2017 692 2 View
The result in ncbi blast was NO SIGNIFICANT SIMILARITY FOUND
18 May 2017 4,196 1 View
Hi, I have been trying to sequence a mouse antibody but I get a +1 frameshift at the CDR3 junction for both light and heavy chains. Does anybody know what is the right sequence and why it does...
18 May 2017 8,897 1 View
Hello everyone, I have got sequences of the gene I have been working on and its two paralogs. As we know that they are expressed into the plant so I want to know the sequence similarity between...
15 May 2017 625 6 View
Hello, everyone: Recently, I was trying to build 3D structure of one protein which has no crystal structure, I was wondering some questions. First, what are the lowest threshold of sequence...
15 May 2017 7,908 2 View
gene bank ID is (L43921) but I am facing trouble while downloading the exact sequence i am looking for? The length of the desired gene sequence is 900 bp, anyone who can paste the sequence and...
12 May 2017 1,976 2 View
Hi everyone! I am using a 2-step targeted amplicon approach for my Illumina library preparation and I wonder what's the purpose of the second part of the Nextera adaptors? The entire sequences...
11 May 2017 8,274 6 View
(1) How can we find the partial sum of n1000 instantly ? (2) is there is a simple method to find partial sum of the sequence f(n) ? (3) Any general method to compute...
07 May 2017 7,421 3 View
I want to design a single primer pair for a particular genus, involving its 5 species, so that while performing PCR, we involve a single primer pair, instead of 6 primer pairs.
06 May 2017 8,783 2 View
Hello, I am trying to find the best way to deal with PCR duplicates in ddRAD data. I was wondering if there is a reliable way to identify and exclude them in a dataset that has been produced...
02 May 2017 10,011 3 View
In case p≥1, it is a classical result on convolution (discrete Young inequality)
01 May 2017 997 1 View
Our lab has sent rat cardiac tissue for sequencing and have obtained indigestible fastq data files. Is there a software I can use to organize these fastq sequence files in order to...
28 April 2017 7,891 3 View
Is size of over 400bp too big?
27 April 2017 3,664 2 View
Hello dear friends Can anyone suggest me, please , why we remove stop codon when protein sequence is to be analyzed and classified in Interpro? When i search the sequence with stop codon i m...
27 April 2017 4,110 2 View
Helle!I need to verify my miRNA microarray results with qPCR, and I have Agilent kit for RT-qPCR miRNA 1st-strand cDNA synthesis kit (#600036) and miRNA qPCR kit (#600583). It has some kind of...
26 April 2017 5,726 1 View