Contact experts in Sequencing to get answers
2,571 views 596 posts
Questions related to Sequencing
I used universal sequencing primers i.e, CMV-F and BGH-R. Could someone suggest what is the issue? Is it the primers, if not then what could it be?Sequencing reaction is not at all working....
14 June 2017 10,060 5 View
Hello I need to delete up to 30 bp from a plasmid to generate deletion mutation. Has anyone tried using Agilent direct mutagenesis to delete longer regions? How feasible is this?
12 June 2017 5,069 3 View
Does anyone have experience with Sequel sequencing, and what did you think of the quality and usability of the output?
12 June 2017 1,454 3 View
Hi all, How to generate in matlab, a golay sequence of N elements?
12 June 2017 7,003 2 View
How to use software Geneious to find genomic features such as genome size, GC content, tRNA genes, CDS etc?
11 June 2017 1,280 1 View
I want the researchers who have the primer collection related to my question to answer my question. Thank's a lot.
10 June 2017 9,772 2 View
I have around 30 k sequences and need to find the codon frequencies how to deal with the presence of Ns in the sequence should i need to mask the regions or to replace with specific nucleotides...
09 June 2017 5,710 3 View
can any one tell that is it possible to differentiate between the three sequences (having same size) and obtain their individual sequence in the same sequencing reaction and if yes then what is...
07 June 2017 9,996 5 View
Hello, I want to identify Cryptosporidium and Giardia from samples of rivers, so I wanted to know if it's better to use a nested PCR and what protocol should I use. Thanks.
06 June 2017 2,859 7 View
Any linker sequence should add between the myc-tag and the insert sequence? Thank you very much!
02 June 2017 7,339 2 View
Currently, I am working in crec of uf, in florida. Our sanger sequencing results are not so good very often. So we want to change the company. So if you get better sanger sequencing company...
31 May 2017 1,127 2 View
I am trying to produce RNAs ranging from 17 to 60 nt to for a gel shift experiment. For the longer ones, I've already had decent success using two partially-overlapping oligos (filled in with...
30 May 2017 6,579 4 View
Hello, I have some .FASTQ files from Illumina solexa sequencing. Now I want to analyse the OTUs, generate heat map and other relevant information about the microbial biodiversity. I am trying it...
29 May 2017 8,176 1 View
Suppose this is the designed antisense oligo for Nicotiana tabacum (NtVI A3.6 722L20 5’CTATCTTCTTCTGCACTTCG 3’). I want to check on target and is their any off-target site.When i am doing...
26 May 2017 3,445 2 View
I have many sequences from the environment to do function gene but I am not experienced analysis sequence to get the phylogenetic tree, please could someone help me step by step how I can do this?...
24 May 2017 8,798 4 View
Is there any specific sequence different from TATA for the TATA box in fungi?i had about 61 base pairs deletion upstream and 462 base pairs deletion downstream of the first transcription ATG but...
23 May 2017 10,196 3 View
i have ITS and Rbcl sequences and i want to analyse for combination of markers. can anyone suggest me how to do
21 May 2017 4,864 1 View
For instance, how we generate an accurate results of detecting occlusion in a sequence of images in real time ?
20 May 2017 5,753 1 View
The m6A (N6-Methyladenosine) modification on RNA has a RRACH motif, so what about the 6mA (N6-Methyladenine) modification on DNA? Is there any specific sequence found though mapping its...
19 May 2017 757 2 View
The result in ncbi blast was NO SIGNIFICANT SIMILARITY FOUND
18 May 2017 4,254 1 View
Hi, I have been trying to sequence a mouse antibody but I get a +1 frameshift at the CDR3 junction for both light and heavy chains. Does anybody know what is the right sequence and why it does...
18 May 2017 8,950 1 View
Hello everyone, I have got sequences of the gene I have been working on and its two paralogs. As we know that they are expressed into the plant so I want to know the sequence similarity between...
15 May 2017 676 6 View
Hello, everyone: Recently, I was trying to build 3D structure of one protein which has no crystal structure, I was wondering some questions. First, what are the lowest threshold of sequence...
15 May 2017 7,980 2 View
gene bank ID is (L43921) but I am facing trouble while downloading the exact sequence i am looking for? The length of the desired gene sequence is 900 bp, anyone who can paste the sequence and...
12 May 2017 2,033 2 View