Contact experts in Sequencing to get answers
1,397 views 559 posts
Questions related to Sequencing
Are the black boxes supposed to indicate exons? If so is the furthest black box at the start of the gene the promoter region? This is the - strand so the gene is read right to left.
07 July 2017 5,954 3 View
Hello everyone. Can some one help me?
06 July 2017 5,440 3 View
Sanger Sequencing result shows my insert sequence is perfectly right but, as being said in the question, the vector sequence is a mess. Not only is it about a few random substitution or deletion...
03 July 2017 5,190 2 View
Dear Colleagues and Mentors, Hope you all are doing fine. I'm trying to sequence a gene which has partially sequenced before. Now, our plan is extend the sequence or if possible get the whole...
24 June 2017 8,664 4 View
Has anyone used pig targeted gene expression using MiSeq (Illumina)? I have been looking into the literature but no success.. There are definitely pre-made library kits for Human, Mouse and...
22 June 2017 2,499 1 View
I'm looking for sequencing services between one tube sanger sequencing and Next Generation Sequencing. I need several hundreds reads to analyze a library of DNA, I can't manage it tube by tube,...
21 June 2017 5,196 1 View
I want any information about long chain PCR to detect long deletions.
21 June 2017 4,282 2 View
Hello, I want to look into MiSeq technique for gene expression analysis. I would like to know if there are any tips, guidelines or suggestions. Also if there are other ways to choose a...
20 June 2017 2,334 3 View
I used universal sequencing primers i.e, CMV-F and BGH-R. Could someone suggest what is the issue? Is it the primers, if not then what could it be?Sequencing reaction is not at all working....
14 June 2017 9,984 5 View
Hello I need to delete up to 30 bp from a plasmid to generate deletion mutation. Has anyone tried using Agilent direct mutagenesis to delete longer regions? How feasible is this?
12 June 2017 4,983 3 View
Does anyone have experience with Sequel sequencing, and what did you think of the quality and usability of the output?
12 June 2017 1,378 3 View
Hi all, How to generate in matlab, a golay sequence of N elements?
12 June 2017 6,886 2 View
How to use software Geneious to find genomic features such as genome size, GC content, tRNA genes, CDS etc?
11 June 2017 1,161 1 View
I want the researchers who have the primer collection related to my question to answer my question. Thank's a lot.
10 June 2017 9,698 2 View
I have around 30 k sequences and need to find the codon frequencies how to deal with the presence of Ns in the sequence should i need to mask the regions or to replace with specific nucleotides...
09 June 2017 5,613 3 View
can any one tell that is it possible to differentiate between the three sequences (having same size) and obtain their individual sequence in the same sequencing reaction and if yes then what is...
07 June 2017 9,901 5 View
Hello, I want to identify Cryptosporidium and Giardia from samples of rivers, so I wanted to know if it's better to use a nested PCR and what protocol should I use. Thanks.
06 June 2017 2,752 7 View
Any linker sequence should add between the myc-tag and the insert sequence? Thank you very much!
02 June 2017 7,266 2 View
Currently, I am working in crec of uf, in florida. Our sanger sequencing results are not so good very often. So we want to change the company. So if you get better sanger sequencing company...
31 May 2017 1,054 2 View
I am trying to produce RNAs ranging from 17 to 60 nt to for a gel shift experiment. For the longer ones, I've already had decent success using two partially-overlapping oligos (filled in with...
30 May 2017 6,514 4 View
Hello, I have some .FASTQ files from Illumina solexa sequencing. Now I want to analyse the OTUs, generate heat map and other relevant information about the microbial biodiversity. I am trying it...
29 May 2017 8,097 1 View
Suppose this is the designed antisense oligo for Nicotiana tabacum (NtVI A3.6 722L20 5’CTATCTTCTTCTGCACTTCG 3’). I want to check on target and is their any off-target site.When i am doing...
26 May 2017 3,367 2 View
I have many sequences from the environment to do function gene but I am not experienced analysis sequence to get the phylogenetic tree, please could someone help me step by step how I can do this?...
24 May 2017 8,706 4 View
Is there any specific sequence different from TATA for the TATA box in fungi?i had about 61 base pairs deletion upstream and 462 base pairs deletion downstream of the first transcription ATG but...
23 May 2017 10,089 3 View