I am trying to produce RNAs ranging from 17 to 60 nt to for a gel shift experiment. For the longer ones, I've already had decent success using two partially-overlapping oligos (filled in with Phusion polymerase) as a template. I'm using a T7 promoter (TAATACGACTCACTATAGGG). For the shorter ones, I'm considering using the asymmetric hybrid strategy: annealing a top-strand oligo (containing the promoter sequence only) to a bottom-strand oligo (40-30 nt long) that has the whole template sequence.
My questions are:
1) For either PCR or annealed oligo templates, should I include a few nucleotides upstream of the promoter, as mentioned in the Sauer lab IVT protocol or the Ambion MEGAshortscript kit manual? Or is it unnecessary?
2) Has anyone had success with the "asymmetric hybrid" oligo templates?
http://www.openwetware.org/wiki/Sauer:In_vitro_transcription_with_T7_RNA_polymerase
Hi Andrew,
to answer question 1: I have had successful in vitro transcriptions using templates without any overhangs upstream of the promotor. However, I have never compared efficiencies with and without overhangs.
I have not used asymmetric hybrids, as far as I remember, so cannot comment on question 2.
An additional remark - if you want to obtain homogeneous, defined 3'-ends, it helps to have a ~2 2'O-Me-nucleotides on your template strand. These would be at the 5'-end of your template strand/reverse primer. This has helped me, especially for transcription of shorter RNAs, as otherwise you tend to get additional non-templated nucleotides incorporated at the 3'-end of your RNA.
Hope this helps!
Hi Andrew,
I am struggling in vitro transcription for short 22 mer RNA. I use annealed DNA template (symmetric). But when I check the transcription results on gel I get blank gels. Could you please help me troubleshoot it?
Thanks
Surbhi,
First question: do you have a T7 promoter upstream of your template? Nothing will happen without it. If you do have that, and you're not sure if your enzyme or other component of the reaction is the problem, you'll need a positive control. You might be able to find one in the kit you're using. If you're not using a kit, find a plasmid that has a T7 promoter and digest the plasmid so as to isolate a linear fragment that contains the entire T7 promoter. If your lab does any kind of cloning, you should be able to find it.
Andrew,
I have T7 promoter upstream of my template. I use TranscriptAid T7 High Yield Transcription kit from ThermoScientific. I didn't get the results for its control reactions either. I have also tried a combination of buffers and polymerases from different sources but yet its not working out. The gels run blank.
- Badges
- Science method
- Similar topics
- Biological Science
- Genetics
- Genetic Analysis
- genetic techniques
- Sequencing