Contact experts in Quantitative RT-PCR to get answers
1,123 views 901 posts
Questions related to Quantitative RT-PCR
Hello everyone I conducted sequencing prosedure for RNA genome segment (about 700nt) , for this reason I employed the random hexamer primer for cDNA synthesis . after sequencing (by sanger...
17 August 2020 4,129 3 View
I am working for a small CRO which hopes to validate my qPCR method prior to purchasing a qPCR machine. I have attempted to validate my method using a conventional PCR machine while measuring...
05 August 2020 4,077 4 View
We would like to do a LUMINEX assay with the Bio-Plex Pro™ Human Cytokine 27-plex kit.
26 July 2020 2,867 1 View
Just wanna make sure i understand right.
25 July 2020 5,342 4 View
I am currently screening for antibiotic resistance in strains of Staphylococcus aureus, the strains that I am using are already assembled, sequenced and annotated. I have used ResFinder to screen...
09 July 2020 5,528 2 View
I have got zebrafish knock-out mutants with crisper-cas9 method, I only observed mutant possessed obvious phenotype and did genes qRT-PCR analysis. however, I didn't know how to design next step...
28 June 2020 3,422 0 View
I know the theory says that transcription starts at +1. However, sometimes transcription can start at a different position (see for instance the article "RNA Polymerase II Activity of Type 3 Pol...
18 June 2020 5,780 1 View
Dear All, I have a very basic question about the PCR/RT-PCR/qPCR. The PCR primers and TaqMan probes are designed such that the primers/probe connot bind to the mismatched site but only...
16 June 2020 5,001 3 View
I have obtained a forward sgRNA sequence through sgRNA design tool as follows: TCCCCAATCTGGGCGCGCGC As far as I know, it will bind to the antisense strand right before NGG (PAM). However,...
08 June 2020 7,919 0 View
I am knocking down each member of a family of 3 proteins, however I'm noticing that two members are getting knocked down at once due to high sequence homology (80% with BLAST). Is there a way I...
04 June 2020 6,497 3 View
Hello everyone, I am looking at markers that I can use for qPCR to check the phenotype of microglia after primary microglia culture. I found a protocol to prepare microglia from pups but I would...
29 May 2020 6,676 5 View
I am trying to understand the "self complementarity" term in PCR primer design. As I understand, it is desired to have the score less than 4 matches for the 3' end to avoid heterodimer structure....
12 May 2020 649 0 View
I am very new to NGS analysis and will be analysing MNase data soon. MNase is used to identify nucleosome positions genome wide. I read papers and observed that normalized tag densities are used....
11 May 2020 5,597 0 View
Does anyone know of a conversion chart or formula to convert values from peak torque via isokinetic analysis (Nm/kg) to pounds (lbs)? Peak torque values will be normalized to the participant’s...
08 May 2020 3,962 0 View
Dear everyone, May I please get your help with primer dimer issue in sybr green qPCR reaction? Our lab is working on developing diagnostic methods based on cell-free RNA from plasma. We are...
24 March 2020 9,518 5 View
I conducted qPCR to analyse the gene expression of 5 genes. I used GAPDH as the reference/control gene. Everything was run in triplicate. I have calculated the delta-Ct, delta-delta-Ct values...
23 March 2020 5,000 9 View
Hi everyon! It's a long question, and I hope I'll be able to explain myself well. I did a RT-PCR reaction for CD11b with a housekeeping genes panel, to pick one that best suited my cells. Overall,...
19 March 2020 696 5 View
e.g growing trophoblast, endothelial cells, & stromal cells together.
26 February 2020 9,823 2 View
Hi ALL, I am trying to do the qPCR and detect the BNDF gene in the mammary tissue. But the CT in my experiment is about 32. I know it means nothing! But in our previous experiment, the CT is...
13 February 2020 5,719 2 View
Hi Everyone: I am studying a protein that is hypothesized to assist in transcription elongation. Its knockdown is expected to lead to decreased RNAPII processivity. I am trying to test this...
12 February 2020 556 4 View
Guys, I have a High capacity cDNA reverse transcription kit, but it has been expired for 5 months. I would like to konw if the enzime is working yet. Should I buy a new kit? Thank you.
21 January 2020 3,340 4 View
I am planning to design Revers primer and add His-tag to it . His-tag sequence is CAT CAT CAT CAT CAT CAT (6 histidin). They are added to Revers primer but : Should they be added to Revers primer...
10 January 2020 463 3 View
I have a sample of juice. I want to measure the antioxidants activity ( Dpph ) pleas i needed the procedure for this essay
09 January 2020 286 4 View
Hi all, I have gone through previous threads and numerous publications trying to find the best gene to use for qPCR with LPS activated macrophages (BMDMs) and microglia, and I understand everyone...
06 January 2020 802 4 View