Contact experts in Quantitative RT-PCR to get answers
1,498 views 1,226 posts
Questions related to Quantitative RT-PCR
Is there a reliable method for isolation of DNA binding proteins with genomic DNA that doesn't require fixation of said proteins to the DNA? My goal is to isolate genomic DNA with all of the DNA...
18 June 2020 1,646 0 View
I have a load of Genbank accession numbers for which I need to get the associated specimen voucher data. Is there an easy way to do this? I've been using the "Send to" option to export accession...
18 June 2020 8,162 0 View
Dear All, I have a very basic question about the PCR/RT-PCR/qPCR. The PCR primers and TaqMan probes are designed such that the primers/probe connot bind to the mismatched site but only...
16 June 2020 5,029 3 View
I have obtained a forward sgRNA sequence through sgRNA design tool as follows: TCCCCAATCTGGGCGCGCGC As far as I know, it will bind to the antisense strand right before NGG (PAM). However,...
08 June 2020 7,928 0 View
I used glycerol in place of immersion oil to see the bacteria under the microscope but i didn't observed bacteria.Suggest any other oil which can be used for the same in place of immersion oil.
06 June 2020 4,975 0 View
I am knocking down each member of a family of 3 proteins, however I'm noticing that two members are getting knocked down at once due to high sequence homology (80% with BLAST). Is there a way I...
04 June 2020 6,508 3 View
Hello everyone, I am looking at markers that I can use for qPCR to check the phenotype of microglia after primary microglia culture. I found a protocol to prepare microglia from pups but I would...
29 May 2020 6,709 5 View
If you have read this article I need your help please. What is a protein with natterin structure? What characteristics does it have? Why is a UI control used, Lacz? Does the mosquito produce...
20 May 2020 1,573 0 View
I am trying to understand the "self complementarity" term in PCR primer design. As I understand, it is desired to have the score less than 4 matches for the 3' end to avoid heterodimer structure....
12 May 2020 662 0 View
I am very new to NGS analysis and will be analysing MNase data soon. MNase is used to identify nucleosome positions genome wide. I read papers and observed that normalized tag densities are used....
11 May 2020 5,608 0 View
Does anyone know of a conversion chart or formula to convert values from peak torque via isokinetic analysis (Nm/kg) to pounds (lbs)? Peak torque values will be normalized to the participant’s...
08 May 2020 3,975 0 View
Dear all, I have an RNA seq data and I have many genes whose expression are altered by my treatment. However, The up-regulation pattern is generally about %50 (which makes Log2foldChange value 1....
08 May 2020 1,340 7 View
I've succesfully run Trinotate for functional annotation of a Trinity assembly. One of its output files is the report table 'Trinotate.xls'. This table has several transcripts without any BLASTX,...
29 March 2020 3,395 2 View
Dear everyone, May I please get your help with primer dimer issue in sybr green qPCR reaction? Our lab is working on developing diagnostic methods based on cell-free RNA from plasma. We are...
24 March 2020 9,536 5 View
I conducted qPCR to analyse the gene expression of 5 genes. I used GAPDH as the reference/control gene. Everything was run in triplicate. I have calculated the delta-Ct, delta-delta-Ct values...
23 March 2020 5,014 9 View
I've been attempting to run a western blot analysis on some collagen samples and have been running into issues with the transfer process. I've gotten bands to show up on the membrane for all...
23 March 2020 7,084 0 View
Hi everyon! It's a long question, and I hope I'll be able to explain myself well. I did a RT-PCR reaction for CD11b with a housekeeping genes panel, to pick one that best suited my cells. Overall,...
19 March 2020 705 5 View
e.g growing trophoblast, endothelial cells, & stromal cells together.
26 February 2020 9,835 2 View
Hi ALL, I am trying to do the qPCR and detect the BNDF gene in the mammary tissue. But the CT in my experiment is about 32. I know it means nothing! But in our previous experiment, the CT is...
13 February 2020 5,734 2 View
Hi Everyone: I am studying a protein that is hypothesized to assist in transcription elongation. Its knockdown is expected to lead to decreased RNAPII processivity. I am trying to test this...
12 February 2020 578 4 View
Countries implementing the EITI can become EITI Candidate Countries when the EITI Board is confident that the country has made a political commitment and has taken a number of preparatory steps....
30 January 2020 8,322 15 View
The process, which is carried out if necessary, is performed by the method of analyzing the specified conditions of use and assessing the conformity of product characteristics to these...
30 January 2020 8,380 26 View
Guys, I have a High capacity cDNA reverse transcription kit, but it has been expired for 5 months. I would like to konw if the enzime is working yet. Should I buy a new kit? Thank you.
21 January 2020 3,355 4 View
I'm used an expired kit 4 months ago for transcription and my samples didn't amplify
21 January 2020 2,031 2 View