Hi all, my name is David
Previously I cloned a protein and everything was perfect. However now I want to clone this same protein but with a PelB sequence in its N-terminal for that I designed the same primers but adding the nucleotide sequence of the PelB in 5'. But now the PCR doesn't run and its seems like the primer annealing between theirs or there are some secondary structure. How can solve this problem?
The primers are:
Fwd: aggagatataccATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCGAAATCGTCTTGACTCAATCTC
Rv:
GTGATGGTGATGTTTTTTATCATCATCATCCTTATAGTC
The PCR protocol:
2' 95
45'' 95
1' 60 ( 60 is the Tm which ran the first time but I tried another two Tms 55 and 65)
2' 72
10' 72
30 cycles 2-4
Many thanks!
David
If you are getting a low size blurred amplimer at about 100 bases then it is primer dimer . One way of minimising PD is to use less primer (half or quarter of current use) and use a hot start enzyme or a manual hot start.....add the enzyme to the pre heated ( 80 c) reaction mix then the enzyme is not active at the low temperature needed for the primers to anneal to each other ( or even one primer to anneal to itself)
- Badges
- Science method