Does sgRNA binds to ...NGG antisense-strand and CCN... sense-strand?

Nadia Cipta @Nadia-Cipta

08 June 2020 0 8K Report

I have obtained a forward sgRNA sequence through sgRNA design tool as follows:

TCCCCAATCTGGGCGCGCGC

As far as I know, it will bind to the antisense strand right before NGG (PAM).

However, will it bind to the sense strand following a CCN motif?

In other words, does one sgRNA target both sense and antisense strand?

Badges
Science method

More Nadia Cipta's questions See All

Why does kaleidoscope Marker miss Bands in the middle??

We had several times the problem after the transfer: you can detect the yellow 10 kDa Band, the blue 20 kDa Band, the pink 25 kDa Band but after only the pink 75 kDa Band. 15, 37 and 50 kDa are...

02 February 2021 4,936 3 View

What's difference between NH4+ and NH4+-N, NO2-and NO2-N, NO3- and NO3-N?

Hello, Upon writing my paper, I noticed that most journal papers stated the concentration of all nitrogen compounds in -N , example instead of NH4+ its NH4+-N. I knew that the -N form uses the...

14 December 2020 3,693 3 View

Where and how do I specify frequency in the route section of frequency-dependent calculation (Gaussian using Linux)?

Hello everyone. I would like to compute the dynamic hyperpolarizability value of a molecule using Gaussian on Linux OS. I have read that the essential keywords to include for such request are the...

07 November 2020 5,620 4 View

How do I calculate theoretical fluorescence spectra (TDDFT) in Gaussian 09W in selected solvent?

Good day everyone. I am new to computational chemistry and would like to integrate some part of it in my fluorescence study. I would like to investigate the theoretical fluorescence spectra using...

18 September 2020 6,742 3 View

No title

I have an AlN sample and the EDX data show me the at% of a single atom such as Al, N and O . In order to measure the at% AlN , I have to use the chemical formula 2AlN = 2Al + N 2 . should I use...

20 August 2020 6,269 3 View

What is the impact of solder mask and Surface finish on antenna performance?

Hello everyone, I am working on the design and fabrication of a butler matrix connected to an array antenna. The structure operates at 3GHz. In fact, during the design, I did not include any...

31 May 2020 1,873 2 View

How to simulate a bio inspired Artificial Optimization algorithm based geocast routing for VANET?

I would like to simulate a bio-inspired optimization based Geocast routing for VANET using a clustering algorithm in ns3 or Omnet++ with SUMO. And , evaluate my approach with other existing...

23 February 2020 8,108 4 View

Looking for protocol: mitochondria isolation from treated cell line with subsequent Analysis in Seahorse XFP (8well)?

Hey guys, i would like to know, if there is any existing protocol, how to isolate mitochondira from treated cells and use them further in Seahorse XFP Mito Stress test for 8well plates? Second...

29 October 2019 7,474 1 View

How may I clone a 5415 bp gene into pglo plasmid (5371 bp) replacing it's GFP gene (~700 bp)?

I need to clone a 5415 bp gene into pglo plasmid replacing it's GFP gene which is around 700bp long. Now PCR amplification of this 5415 bp gene using PhusionR HiFi Taq doesn't show any band, only...

05 October 2019 4,938 7 View

Wich is the post-hoc test for Conway-Maxwell-Poisson (COM-Poisson) distribution?

I used the Conway-Maxwell-Poisson distribution for my underdispersed count data. Now I'm interested in compare the treatment but I don't found the script for it. For the others dsitributions...

10 September 2019 6,835 3 View

How can I completely delete a protein on the genomic level using Crispr?

I want to completely delete or largely truncate a gene and not only achieve a functional knockout in a cell line. I can only transfect my cells with the Crispr/Cas9 sgRNA RNP and not introduce a...

08 February 2021 2,032 2 View

Does gene insertion via CRISPR/Cas9 result in chromosomal abnormalities?

Hello, I hope to insert a gene into mammalian cells in culture using CRISPR/Cas9 and an HDR template. Will insertion of a 1 kilobase gene cause chromosomal abnormalities and effect cell...

31 January 2021 2,516 1 View

Do I need to add a start codon and stop codon for the sgRNA expression in crispr?

Dear All, I am now designing the sgRNA for knocking out the gene through crispr. Base on my learning experience, a start codon and a stop codon should be put in the N terminus and the C terminus...

16 December 2020 5,795 3 View

How big can a enhancer deletion be ? how can we obtain homologous deletion clone ?

Hi all, I have tried to use Crispr Cas9 ( plasmid px333_cas9_mCherry) to delete some enhancers. I designed sgRNA using Chopchop website to target both sides of an enhancer to induce homologous...

13 December 2020 942 3 View

Where can I find off targets for Apis mellifera?

I would like to find off target sites for my sgRNA, however the more commonly used off target finders do not include apis meliifera, is there an application or website that would allow me to do...

09 November 2020 3,463 1 View

Why do I get a lot of colonies upon transformation of digested lenti guide puro?

I digested my lenti guide puro plasmid. The only modification in this plasmid is that it has blasticidin resistance gene instead of puromycin. I get the desired bands at ~8kb but I do not see the...

03 August 2020 2,854 4 View

Does this cold spring harbor protocol really edit circular dna with pcr?

Hello - I am studying this protocol which claims to use pcr to clone in/replace a small piece of an sgrna plasmid with a new guide sequence provided by an oligo with homology to the sgrna...

02 March 2020 6,358 2 View

Opinions on using PCR to re-target plasmid sgrna, with a "universal" sgrna scaffold?

I am using the following protocol from a CSH lab manual edited by Doudna on CRISPR, to attempt to retarget sgrna scaffold in a plasmid. but....I get DNA stuck in the well, not migrating....

01 February 2020 6,327 3 View

How do I rank CRISPR sgRNA pairs by on-target activity?

I am currently trying to generate CRISPR sgRNA pairs with Sanger Institute's online genome-editing tool. I enter the sequence of interest and it generates hundreds of sgRNA pairs, which I can rank...

09 October 2019 4,289 2 View

Multiple sgRNA cloning into pX333 plasmid using BsaI and BbsI restriction enzyme site?

Currently, I am using a plasmid containing two gRNA cloning site. The restriction enzymes used for cloning gRNAs into this plasmid, pX333, are BsaI and BbsI. I digested the pX333 plasmid using...

09 October 2019 2,743 6 View