In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short... | Contact experts in PCR to get answers
8,704 views 3,820 posts
Questions related to PCR
In designs performed in ETABS software, better responses were obtained from this type of steel section.
16 February 2025 6,062 3 View
Does anyone have a PDF file of the book, Plant Pathology by Agrios??
14 February 2025 8,508 2 View
Imbalanced datasets are a common challenge in AI and machine learning, leading to biased models that favor majority classes while underrepresenting minority classes. This bias can significantly...
13 February 2025 2,964 3 View
Which is the best silver nanooxide, copper nanooxide or zinc nanooxide in bacteria resistance? why
08 February 2025 9,561 1 View
Describe the Most Diagnostic Radiographic Method to Identify and Locate Them
30 January 2025 6,485 1 View
I'm working with iPS cells, and I know that some researchers here have been facing the same problem as I am: black dots appearing on the adherence matrix (Geltrex, in my case). Every time I do a...
27 January 2025 7,663 2 View
Hi, I have a question regarding DNA extractions. I follow a magnetic bead based protocol for DNA extraction and at the end of the protocol, there is a step to spin down the DNA samples which are...
22 December 2024 9,565 1 View
Dear colleagues! Maybe someone has a questioner about female information regarding urinary incontinences? I would greatly appreciate it if you could send this questioner?
21 December 2024 4,550 0 View
whole body CT Scans are negative: is it good idea to proceed with PET Scan?
13 December 2024 4,495 2 View
I found it in an article and I do not know the difference between training set and test set! 700 patient samples collected at 9 sites were measured in the training study. It included patients with...
08 December 2024 7,805 2 View
I have come under situation where LCOE decreased gradually till around 600kW to 650kW before it increased slightly. Moreover, LCOE intersected at around 500kW- 550kW. There is less MWh curtail...
04 December 2024 5,355 0 View
what is the role of NaOH during the synthesis of zinc nanoparticles? does it directly participate in the zinc reduction reaction? does OH compete with the plant extract in synthesizing zinc...
28 November 2024 7,346 4 View
I am trying to create a consensus ultrametric phylogenetic trees with a file with multiple trees (around 100), where the branch lengths correspond to time. However, functions like consensus() in R...
22 November 2024 278 0 View
According to the black hole information paradox, the information that enters a black hole is lost forever, which contradicts fundamental principles of quantum mechanics that prohibit the loss of...
12 November 2024 8,235 7 View
To confirm the experiment of the quantum jump of the electron through a contraction in the fabric of space-time, an experiment must be conducted to prove the validity of the equation by using...
11 November 2024 8,865 3 View
I am using 1% gelatin coated slides for performing histology. However, the background of the slides coated with gelatin are also getting stained along with tissue sections and it makes imaging...
11 November 2024 3,493 2 View
Protocol Used 1. The slides were dipped in a trypsin jar for 15 seconds. 2. Immediately after, the slides were dipped in PBS for another 15 seconds. 3. Giemsa stain was applied, and the slides...
05 November 2024 426 0 View
The early diagnosis of Alzheimer's disease (AD) has become important to the reversal and treatment of neurodegeneration which may be relevant to premature brain aging associated with chronic...
28 October 2024 6,878 1 View
I ordered a primer when I received it where one nucleotide is different in the forward primer. the original sequence is: CTCTTTGGGCTCAGAGTGAGTCTGG the sequence which I get:...
24 October 2024 9,424 7 View
I want to insert a gene in a vector using restriction cloning, but the enzyme that I have to use has three restriction sites in the vector. It is imperative that I use only this enzyme and no...
17 October 2024 1,518 5 View
Can the Cre-LoxP system be used clinically trial? Can a residual loxp site be harmful to the human body?
16 October 2024 842 5 View
Hydranencephaly (not to be confused with hydrocephaly) is a condition in which the neocortex fails to develop due to neonatal stroke, for example, whereby the space normally occupied by the...
16 October 2024 5,029 0 View
Who can help me for the PDF of the following two paper? Thank you for all your kind helps!
14 October 2024 3,952 0 View
Input msi2lmp.exe MDT_2 -class 2 -frc pcff.ver.3.1 -ignore Output Running msi2lmp v3.9.9 / 05 Nov 2018 Forcefield: Class II Forcefield file name: ..\frc_files\pcff.ver.3.1.frc Output is...
25 September 2024 7,846 0 View