I ordered a primer when I received it where one nucleotide is different in the forward primer.
the original sequence is: CTCTTTGGGCTCAGAGTGAGTCTGG
the sequence which I get: CTCTTTGGGTTCAGTGTGAGTCTTG
Three nucleotides (Bold) are different
This primer will work?
while I have tried so many times but there is no result. If it is working, how can I fix my PCR protocol?
It might still work but the annealing conditions at least for the first round may need to be at lower temperature. I would probably set the annealing temperature at about 48C.
The mismatch at the 3' end could be more problematic, try lowering the elongation temperature as well between 62-65C
For troubleshooting, I recommend first lowering your annealing temperature by 5°C from your current protocol, as this can help accommodate the mismatches by providing more permissive binding conditions. If this doesn't work, gradually increase your MgCl2 concentration by 0.5 mM increments and extend the annealing time to 45-60 seconds to allow more time for primer binding. A touchdown PCR approach could also be beneficial starting with a higher annealing temperature and decreasing it by 0.5°C each cycle for the first 10 cycles. And if still doesn't yield results, unfortunately you need new primers.
Just buy a new primer! It's not worth your time or reagents to try and get a faulty primer to work. Primers are cheap.
Actually you have to change the annealing temperature and redo the experiment. Concentrate and modulate only annealing temperature, surely results will be best
The most problematic is the extra-T at the 3'-end because this destroys the binding site for DNA polymerase. Actually it is possible to force this primer to work, but I would rather follow the Katie's advise. Once again, good job Katie!
Adjust PCR Conditions (if reordering is not immediately possible):
Lower the Annealing Temperature: Reduce the annealing temperature by 2–5°C below the calculated Tm for the mismatched primer. This can improve binding, but success is not guaranteed with three mismatches.
Increase Primer Concentration: Slightly increasing the primer concentration might help compensate for the reduced binding efficiency.
Increase Template Concentration: Using a higher concentration of template DNA might help overcome some inefficiencies caused by mismatched primers.
Optimize Mg²⁺ Concentration: Adjusting the MgCl₂ concentration in the reaction buffer can sometimes improve primer-template binding.
Add a PCR Enhancer: Include additives like DMSO, betaine, or glycerol to improve primer annealing in challenging reactions.
- Badges
- Science method