In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short... | Contact experts in PCR to get answers
2,022 views 3,271 posts
Questions related to PCR
I'm trying to amplify a NRAMP D543N (rs17235409) polymorphism, but I'm not getting succefull. I alredy tried temperature gradient (annealing temperature 56-60°C), MgCl2 optmization (06-1.2uL)...
02 February 2020 1,131 3 View
I have had this problem before and the cause was that I used the same primer twice (reverse+reverse instead of reverse+fordward), but now I am pretty sure I used the correct primers. The protocol...
02 February 2020 5,143 3 View
Hi Dear when i going to perform PCR , i get the band for some samples while not for the rest of the sample. the gene is housekeeping gene so it must be present in all samples
02 February 2020 613 3 View
Hello, It was easy to get the full length of SbBDAH1 (1520 bp) & SbBADH2 (1517 bp) from cDNA using dream taq from thermo scientific, although there were non specific targets and primer...
02 February 2020 3,449 3 View
Does anyone have validated primers for QPCR on SFG retrovirus transduced cells? My goal is to calculate retro copy number in transduced cells, and for eventual titration of retroviral sup. For...
29 January 2020 7,707 0 View
I have a big problem with primer dimer for PCR product I send picture as attach Please what can I do for resolve this problem? Does any one help me? Please Im very appreciated if one tell me...
19 January 2020 3,455 12 View
We are repeatedly troubled with strange Protein bands in PAGE after PCR using Q5 polymerase from NEB. Who has measured the molecular weight of Q5 already and could help us out? Thank you all in...
15 January 2020 4,147 2 View
What are the internal controls that should be involved in PCR?
14 January 2020 5,051 6 View
Hi everyone. Just looking for some thoughts on this. My thinking is that I shouldn't use touchdown PCR to amplify 16S regions in this case because it will cause bias. The primers will already...
10 January 2020 8,671 1 View
Hi everyone, I want to perform DNA FISH on a few genomic locations for polyploidy detection. My lab is new to FISH and on a tight budget so instead of using BAC/plasmid, I'm generating ~10kb...
08 January 2020 2,444 5 View
Dear All We are trying to detect Wolbachia in Culex and Aedes spp (adult, larvae and pupae). Can anyone please tell what would be the preferred approach to start with considering adult...
05 January 2020 6,909 1 View
I usually use automated or column based kits to extract DNA from whole blood (collected from infected animals) and use the DNA for PCR based detection of parasites. However, when there is a delay...
03 January 2020 5,739 3 View
Hi, I am wondering if anybody can help me. Upon trying to run a qpcr plate on the applied biosystems StepOne PCR machine, I get an error message saying 'run aborted, unable to move block within...
01 January 2020 7,937 3 View
Genomic DNA is not present as I used cleaned gene. I used 6 X loading dye which was commercially available
01 January 2020 356 3 View
Dear colleagues, Intergenic spacer is a non coding region between genes. However I have some questions about the intergenic DNA spacers and I wonder if anyone can shed some light? Firstly how...
01 January 2020 539 2 View
01 January 2020 7,165 3 View
Dear all, I have been doing a qPCR recently. In order to eliminate the false positive result, I add some PEG. The effect is good. But i cannot found the mechanism of PEG in PCR. Can anyone...
01 January 2020 5,065 3 View
Hi, I picked up some colonies after electroporation. And I growth those colonies in liquid medium with Erytromycin (200mg/ml). I isolated plasmid after incubation overnight. I did PCR as using...
01 January 2020 9,547 4 View
When I use https://tmcalculator.neb.com/#!/main I often get this message with a recommended annealing temperature of as high as 64 degrees "Why is this annealing temperature so high?...
01 January 2020 337 4 View
Hi, this is the first time I am asking a question here. I am approaching the Gibson assembly technique. I need to clone a fragment contained in a plasmid into a new vector (pBMN). To do that I...
01 January 2020 9,740 6 View
01 January 2020 7,988 5 View
01 January 2020 8,028 1 View
My primers are: 5'- GGCCTGCTGAAAATGACTGAA -3' (reverse) 5'- CTATTGTTGGATCATATTCGTCCAC -3' (forward) I have already tried in 50C, 55C, 57-62C gradient (these are annealing temperature), but it...
01 January 2020 5,974 4 View
I am doing Newcastle Disease Virus PCR, the bands are visible but always on the bottom of the agarose gel and lower than 100 bp even with the positive control and the dna ladder show up perfectly....
01 January 2020 2,057 4 View