Contact experts in Biotechnological Techniques to get answers
1,345 views 331 posts
Questions related to Biotechnological Techniques
Hi, has anyone successfully managed to regenerate these AxyPrep Mag PCR Clean Up beads for multiple use? Thanks, Karl
06 June 2015 2,519 2 View
I expressed protein in P.pastoris and performed zymogram (to check enzyme activity in gel) and did western blotting using Nitrocellulose membrane, in both band observed was in same position...
27 May 2015 8,550 3 View
05 May 2015 9,746 4 View
Oncologist, Molecular biologist, Bio technologist.
05 May 2015 2,596 3 View
Dear All, I synthesized sulfonated reduced GO according to the litterature below. Now I have a very stable dispersion of sulfonated graphene oxide in water (may contain a little bit of HCl,...
08 April 2015 3,631 8 View
04 April 2015 1,771 9 View
We are working on Microalgae biodiesel. For FAME analysis GC MS was carried out without standard run and Peak area and RT is given in data. So from peak area and RT how we can measure the...
28 March 2015 8,226 10 View
I am having issues with the Hg peak retention time stability, and wonder if adding a cleaning regime will help stabilize the system.
03 March 2015 320 4 View
I have used different cell markers such as CD163 and CD206 for M2, but both can be expressed in M1. while for M1, I used 27E10 which can be expressed in M2 too.
03 March 2015 2,569 15 View
We're on the hunt for a good blue light transilluminator. We bought one from Clare Chemical Research a couple years ago but it had to be returned because its ability to filter out the proper light...
03 March 2015 4,085 0 View
Silicate or zeolite membrane? How to synthesize it? In order to get 99% purity of bioethanol.
03 March 2015 5,036 2 View
03 March 2015 2,963 11 View
I have a PCR product sample which was extracted about 1 year ago. I tried to electrophoresis it and a bright band appeared! Then I diluted it 9 times, 4 times and 2 times into 3 tubes and...
27 February 2015 5,914 3 View
I am working on Native electrophoresis but need to improvise in order to get a molecular weight standard as the standard with me is faulty and it takes weeks to order a new one. How do I get...
23 February 2015 4,651 2 View
02 February 2015 1,158 3 View
02 February 2015 2,497 4 View
If i used (Amicon 10,000 MWCO) to concentrate the bacteriocin from MRS broth, the bacteriocin will be at the top part near to the filter or it will be in the bottom container? and what is the...
02 February 2015 1,300 3 View
I am running submerged fermentation of Bacillus with barley husk as carbon source in a bioreactor. When samples are taken, the barley husk particles are also included.However, the amount of barley...
02 February 2015 2,615 14 View
Any author will be fine
03 January 2015 6,439 3 View
I was making the solution of SS DNA. During this I have to sonicate to make working solution. This solution is not working for yeast two hybrid. I have changed all the yeast strain, DNA and medium...
01 January 2015 5,546 3 View
What factors are to be considered in designing mutants to knock out the salt bridges of a humanized antibody fragment(fab)?
01 January 2015 3,388 1 View
I have a 38 mer RNA GGGACAACTGTGTTCACTAGCAACCTCAAACAGACACC that I am trying to cut using a chimera Deoxy(GAAC)--2'Omethyl RNA (ACAGUUGUCCCGCA) to give a smaller RNA. I mixed the rna and chimera...
01 January 2015 209 4 View
I want to transduce my target cells with vectors: pLXSN/SV40 LT and pLPCX/hTERT as it was successfully done by Pan et al. (PMID:20620546) or Bian et al (PMID: 15973764) to achieve cells...
01 January 2015 3,166 1 View
I am trying to amplify target sequence using FFPE DNA. Initially, I managed to get the target band I want although it is weak. However, when I try to repeat the test using same formula, no band...
01 January 2015 7,095 11 View