01 January 2015 4 413 Report

I have a 38 mer RNA 

GGGACAACTGTGTTCACTAGCAACCTCAAACAGACACC

that I am trying to cut using a chimera Deoxy(GAAC)--2'Omethyl RNA (ACAGUUGUCCCGCA) to give a smaller RNA. I mixed the rna and chimera in 1:2 ratios, add RNAse H buffer (NEB) and RNAse H in a 20ul reaction. It doesnt work for me. I have also tried using a buffer containing  50mM Tris–HCl pH=7.5, 100mM NaCl and 10mM MgCl2. 

Is there anyone who has tried it?

More Anjali Pai's questions See All
Similar questions and discussions