I have a 38 mer RNA
GGGACAACTGTGTTCACTAGCAACCTCAAACAGACACC
that I am trying to cut using a chimera Deoxy(GAAC)--2'Omethyl RNA (ACAGUUGUCCCGCA) to give a smaller RNA. I mixed the rna and chimera in 1:2 ratios, add RNAse H buffer (NEB) and RNAse H in a 20ul reaction. It doesnt work for me. I have also tried using a buffer containing 50mM Tris–HCl pH=7.5, 100mM NaCl and 10mM MgCl2.
Is there anyone who has tried it?
How do you know that the reaction has not worked...Have u added RNAse inhibitor( RNAseout---it inhibits all RNAses but RNAseH)...Then take the actual reaction product and one control without RNAseH and run the reaction on 15% denaturing gel. Dont forget to add molecular size DNA marker...run the gel till BPB dye is nearly at 1/3rd distance from bottom of the gel...And then do the EtBr staining...You might be able to visualise the product under UV 254 nm...
Well I do not add RNAse inhibitor but if my reaction worked, I should have a 38 and a 23 mer. I dont see the 23 mer despite running a 15% PAGE UREA gel in the presence of a marker.
Thanks Andrei for the protocol. Although it is the same as the standard protocol, they have tried different concentrations like I have so it is a plus to know that has worked for them.
Aha! The protocol mentioned above or any of the protocols dint mention the same as to end label the RNA with a P32 (using t4 PNK). I have read so many protocols. I simply am testing the activity of RNAse H before my real experiment. I made these oligos anneal as a duplex and then did a IVT to get RNA and used them with RNAse H.
If I may ask what is the profit of P32 labelling?
Well, the oligo was not designed according to the paper you mentioned but another paper I was reading: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1369371/pdf/8608452.pdf . Because this dint seem to work I posted a question when I read your reply and the paper you mentioned. Anyway thanks for the suggestion. I will look more into it for designing oligos.
- Badges
- Science topic