Contact experts in Mice to get answers
10,185 views 7,643 posts
Questions related to Mice
I'm working with primary cultures, but fibroblast cells hinder efficient recovery. I have read that cholera toxin can be used to inhibit fibroblast growth.
20 November 2024 2,969 2 View
What is the perception of parents regarding the importance of socio-emotional skill development through extracurricular engagement?
17 November 2024 1,529 0 View
At what level (threshold value) of demineralization, determined by the Diagnodent device, will changes in the hard tissues of the tooth become irreversible, making remineralization therapy...
13 November 2024 7,343 0 View
Hello Can anyone suggest me ideas and methods to improve underwater wireless optical communications in seas and oceans? It includes everything that can be implemented now and ideas that can be...
11 November 2024 3,310 1 View
We can see only a portion of the universe, and it’s unknown what exists beyond this visible horizon. Could there have been a multiverse, a cyclical universe, or something entirely different?
31 October 2024 3,677 0 View
I found that one-co-author, Donald Ho from Hongkong is not my lab personnel. I guess there are same name as my student. Can I clarify this?
31 October 2024 6,710 0 View
PEI: Polyethylenimine
29 October 2024 7,399 4 View
Hi all, I did experiments with gypsum and calcite in high saline solution to test adsorption some target ions. I would like to support my experimental results with model but i am not very...
27 October 2024 6,503 2 View
Dz13 sequence:C*G*GGAGGAAGGCTAGCTACAACGAGAGGCGT*T*G prime:TGACTGCAAAGATGGAAACG CAGGGTCATGCTCTGTTTCA *epresents a phosphorothioate. Transfection method: Transfect 3 uL Lipo3000 and 2 ug DNAzyme...
24 October 2024 7,824 1 View
ssssss
17 October 2024 3,038 3 View
Hello everyone, I’m planning an experiment to measure the expression of beta defensins in HeLa cells stimulated with Candida albicans using indirect immunofluorescence. I’m wondering if it’s...
16 October 2024 9,552 2 View
Thermal collectors, Flat plate collectors
15 October 2024 4,587 1 View
I am an honours student in the Linguistics Department. I am eager to conduct BNLP research and am interested in pursuing a higher education in this discipline (NLP) . How can I begin taking...
10 October 2024 7,702 3 View
Hello ResearchGate Community! I'm surveying the Generative AI industry and seeking expert opinions to enhance my understanding. I would greatly appreciate your valuable opinions. What type of...
07 October 2024 6,103 4 View
Hi everyone, I have a DNA sequence (Phage DNA) that I want to digest using restriction enzymes to generate fragments of different lengths. However, I suspect that there might be modifications in...
02 October 2024 592 16 View
Hi everyone, I’m currently working on flagella assembly and want to localize the FliN protein in my bacteria. We’ve already attempted to label the protein with eGFP at both the N-terminus and...
27 September 2024 8,024 2 View
Im a biochemist so this really isn't my wheelhouse but can anyone tell me the typically LLoD and LLoQ of NGS like RNA-seq and DNA-seq in molar? Most articles provide them in percentage. With...
25 September 2024 9,674 0 View
Anyone has any experience with YB2 cells ? Compared batch and fed-batch cultures (induplicate) and 2 different time. Batch mode lasted 7 days, peak VCD 8 -10E6 cells/mL, titer 200ug/mL....
25 September 2024 6,932 0 View
Hi all, Thank you in advance. I labelled my membrane receptor (a GPCR 41 kDa; approx 80 kDa with SNAP at N-terminus and nLuc at C-terminus) with SNAP-AlexaFluor-488 (surface/non-permeable) and...
17 September 2024 9,859 2 View
I seek to understand the nature of doula work, basic human needs and the control of female bodies
16 September 2024 8,044 0 View
alphaTUB is building a contemporary parent engagement program that brings families together to improve children's academic performance, behavior, and emotional well-being through structured family...
09 September 2024 7,059 0 View
Children with SEMH could potentially have underlying Attachment, Trauma, Autism, Adhd needs
06 September 2024 3,486 0 View
Dear All, https://forms.gle/ewcSyPpNAZiCgQei6 We invite you to participate in a survey on *Mental Health Challenges Faced by Women in Leadership Roles*. Survey link -...
01 September 2024 358 0 View
The Arab media's role in the killing of Gaza's children?
30 August 2024 5,020 2 View