Dz13 sequence:C*G*GGAGGAAGGCTAGCTACAACGAGAGGCGT*T*G
prime：TGACTGCAAAGATGGAAACG
CAGGGTCATGCTCTGTTTCA
*epresents a phosphorothioate.
Transfection method: Transfect 3 uL Lipo3000 and 2 ug DNAzyme into one well of a six well plate for 48 hours, and detect gene expression by qPCR。
Hello, He Yan--
Nucleic acid modifications to stabilize them against nuclease degradation commonly affect binding affinity and catalytic activity. This is true in the case of phosphorothioate modifications, which can decrease the DNAzyme's binding affinity significantly (up to 10fold). It's very likely that the 4 PS modifications on your Dz13 have resulted in this diminished binding affinity, thus you're seeing a lack of attenuation of c-Jun expression. This could be confirmed with surface plasmon resonance (SPR) experiments comparing the binding efficiency of unmodified Dz13 to your PS modified version, if you have access to such equipment. At the very least, you should make this comparison in your current assays. Good luck :)