This will not be a major problem. The worst that can be done is to have a primer that does not match at the exact 3'-position. Here, the polymerase must add the additional nucleotides to a pre-exiating double-stranded part of the molecule. As you have two A's there, you shouldn't worry too much.

Missing of one nucleotide (A) will not have much effect on PCR conditions or yield of the PCR product.

Regarding online tool- U can go and check on IDT tools (oligoanalyzer) for primer designing. For any set of primers, there are some point to keep in mind-

Whether they are making hairpin loop or not?

Annealing temperature should be compatible, GC content should not be more, Self Dimer formation etc.

If these things are Ok, then nothing to worry.

I imagine the primers as a series of small magnets that locks exactly to the sequence that I need to amplify. If 19/20 magnets are OK it should work OK. However, one magnet will stay floating to the air, so no perfect binding (and result).

yes it will give result , it doesn't effect much. i have also done same mistake but i got the amplified PCR product by changing the annealing temperature.

This mistake will not cost you anything. You will get the amplification.

I am of the same the opinion that the reaction will be successful and may require a slight adaptation of anealing temperature for optimal amplification. However, the second part of the answer by Georgios doesn't seem to be applicable here. "One magnet will stay floating to the air": no, this magnet is actually not present in the primer sequence, it has been omited, so the polymerase will start by adding that missing A to the corresponding product.

Thank you all for your valuable answers. I have got the band but its very light. I have reduced number of cycles from 35 to 25. Is this going to effect the Pcr product as I am working without a positive control I am unable to judge . The annealing temperature given was 55degree for 2.5min . With this primer should I decrease or increase the annealing temp. What would b the suitable temperature??

Hi Narayana,

Your primers have much difference in their GC content and a loss of " A" in the reverse primer has actually reduced the gap but not significantly. You should try to increase your Tm a little more than 55 with diff of 2 deg. u can try a gradient pcr at diff temp. and as from the look of it your primers will work more fine with annealing at 1 min and extension at 90 sec per cycle if your product if more than 600 bp other wise 1 min extesnion per cycle is sufficient. To increase the band intensity try increasing you final extension upto 8 to 10 min.

Also try to do a blast result for your primers against your sample species to see if more than one product is coming it will also give you a idea of your primer conditions.

Gudluck

Hi,

It is OK. you have no problem with this primer. I think the incorrect primer will work better than the correct one. Be sure!

God speed you

i think no problem at all specially it is missing nucleotide not different one and regard annealing T there will be no problem specially in research work you depend on try and error

All good. The missing A will be re-added by the polymerase. But everybody here has said that already. The company will usually provide a calculated melting temperature, however in my hands, the old-school rule "take 2° C for every A/T and 3° C for every G/C pair" works just as fine. For elongation you calculate 1 minute per kb (normal Taq or 2 minutes per kb for a proofreading enzyme (Pfu, Phusion), i like to be on the generous side with the elongation. Good luck. It will work. However, PCR often wants a few tries befiore it works smoothly.

One nucleotide should not make any difference. When we order our primers we try to have the last two nucleotide as 'C's or 'G's. This helps in better binding of primer and removes any chance of over hangs at 3'-end where polymerase starts adding new nucleotide. We also add a 'AT' at 5'-end if we are to use the PCR product for cloning using recombinant technique.

Hope this helps!

It should work. In my case there was mistake in synthesis of the primer that I received and it still worked. It was again a 'A' that was missing. Only thing, in the PCR amplified product, there will be a nucleotide missing. If that does not affect your downstream work, go ahead.

Dear Narayana,

As mentioned above, no problem. you can use it (of course, if your goal is only amplification but not detection of SNP, mutation and ...,)

hii,,

60 to 90 seconds for annealing at 56 is good enough, extension(72 degree 75 to 90 sec) 30 cycles and a final extension of 15 minutes at 72 will positively gv u good amplification.better to cut that band form gel and repeat PCR from that purified product to get more product.

hello

Yes this PCR should work with very less difference in specificity. I too received a primer with missing nucleotide though specificity was there and amplified the right sequence but missing nucleotide was present in primer region.

I am of the opinion, that you will not get the desired results with a wrong reverse primer. To give you an example, a funny thing happened with a very reputed institute with one of my culture. I had asked them to identify the species of the microorganism and they gave me 2 results, i.e. there were 2 species identified, one with the forward primer and the other with the reverse primer. On investigation I found out that they used a wrong reverse primer with an additional nucleotide. Now if you were in my place tell me how many times you would hit your head on the wall and expect it to break.

It is OK to me, lucky you miss last nuclotide. it lokks more stable than your old one. you may need to adjust the annealing temprature according to the new MT.

wishh all the best

Hi

I think its better to try it with a positive control. The miss math is at the 3 end.The3 end is very important. It should be matched.In ARMS PCR base on this 1 miss match we design our primers. I had this problem before and I had to order another primer. Your primers are not design good. Primers should end with G or C not A or T. 2AA at the end will make your primers weak and maybe even nonspesific.

Hi

I would like to correct my response. You don not have mismath. You only have shortened your reverse primer.So, donot wory and use it. But ending to A/T is not good, G/C is really better.

Good luck

If the genome of the organism you are studying is publsidhed, then it is better to check using in silico-PCR methods. You will get to know if the missing nucleotide removes the specificity or leads to an undesirable change in tm.

Try with this link:

http://genome.ucsc.edu/cgi-bin/hgPcr?command=start

Dear Narayana,

I would guess, that your PCR work with both primers!

I think you use same PCR conditions.

Try it! Look for the size of your PCR products. Is the size o.k.?

If possible, sequence on of your PCR products.

Best regards,

Thomas

It is fine, no issue at all. Actually whatever primers you order whether degenerate or gene specific, their purity always vary based on the technique they use for primer designing......Primers can be either PAGE purified or HPLC purified. SO, no worry, go with it. Good luck.

You can work with that primer, no problem. Make the PCR to a temperature not less than 55°C.

Unlabeled primers are so inexpensive. Why not just reorder with the correct sequence?

Check please the program Oligo Analizer, and the correct conditions of the Tm. If the annealing temperatures differ, works with the lowest temperature. I totally agree that it is better than your sequences ending with C or G. Makes a blast and also to ensure that this new change does not have self-complementarity of bases between primers or hairpins. Good luck.

This is absolutely fine. Your primer will work very well. You have to calculate the annealing temperature from the primer Tm and do a gradient PCR with +/- 5degrees the primer Tm to find the exact annealing temperature which will work fine for you.

Still works fine.. just need to optimize by running a gradient PCR

No worries, your PCR will work just fine. However, my concern is the end of your primers. It is always better to have the three end-bases as C/G instead of A/T. Good luck!

This should work, but you might have to reduce the annealing temperature. In the future, it is always best to have a C or G in the 3' position to get 3 hydrogen bonds ( it might have been better to forgat the two 3' A in the RW).

According to analysis of your primers by Primer3 at:

http://bioinfo.ut.ee/primer3-0.4.0/primer3/

The more likely problems with your primers are that they may form primer dimer easily (due to 3' end self-complementarity). Also, Primer3 indicates that the density of C's and G's at the 3' end of your left primer is actually too high. But the criteria applied by Primer3 are generally quite stringent, so it's still possible that your primers will work just fine!

Primer3 output:

WARNING: Left primer is unacceptable: High end self complementarity/High 3' stability; Right primer is unacceptable: High end self complementarity

OLIGO start len tm gc% any 3' seq

LEFT PRIMER 2 19 60.07 63.16 8.00 8.00 CCTCTCTCGAACTCCGGAG

RIGHT PRIMER 77 21 59.04 47.62 5.00 5.00 GTTGTGGAATTACTCGGAGGA

I think your primer will work very well. I recomend to do a gradient PCR for cheking the best anneling temperature. Good luck!

I guess first you need to write the 5'-->3' orientation of the primers...., assuming it is standard from left to write then WHY IT WOULD NOT amplify is beyond any comprehension.....!!!!!? you don't have a MISMATCH at the end.... rather you have one nucleotide absent..... thus the PCR product will either be one nucleotide small... (in case the missing "A" is at 5' end) or if it is at 3' end then Taq polymerase have to start amplifying one "A" earlier then it was supposed to do..... in my opinion you are wasting your time for even asking this question.... as far as Tm values goes single missing "A" would NOT matter that much if you use the over simplified formula of assessing the Tm = 2(A+T)+4(G+C) which means in case of reverse primer the Tm is equal to 62 and Tm for forward primer is 60.... and if you have trouble amplifying the PCR product with such primers then you need to go back to your basics of PCRing......

Yes, the PCR will work. But if you want to clone something I would always order correct primers that you don´t have a frameshift mutation. But for a "normal" PCR your primers are okay.

You can go ahead with the primers you have ordered since only one 'A' is missing at the 3' end, it doesn't make big difference. You should worry only when you have wrong bases in the primers for example T instead of C, A/G, T/A ... so on. At the same time position of missing base is matter, if you have missing base in middle of you primer or any where except at the last position of 3' or 5'. Since you have missing base at end of 3' its not a problem at all. According to me the both primers are same only difference is length of primer 22 and 21. As earlier said by many missing 'A' doesn't make big difference in annealing temp, G and C have much effect on Tm then A/T. So the primer is complete fine and you can use it.

Yes, that´s true. A mutation would only occur if you have a wrong or missing base for example in the middle of the primer.

I agree with Murugesan Raju

No problem, your PCR will work fine if you miss a base at the end of any one primer of the pair.

It is fine sure it is gonna work but the issue is with the specificity. As the missed "A" could be the only mismatching base with non target substrates. If your extract is clean and no worries about aerosol contaminations then it's gonna work

Go in, no problem, just take care about calculating the annealing temp. good luck

No problem at all. Just lower a bit the annealing temp!

It will work. It could chage a little the annealing temperature, but you could test different annealing temperature to know what is the best range.

use gene runner software for designing primer. it will give you probable tm of each primer(fw and rw). try to design both primer at same tm. after designing primer to know accurate annealing tm. put gradient pcr with DNA(+ve control). e.g. your designed primer tm is FP-58 AND RP-60 then put gradient pcr from 57-61tm. then see for more intense band you are getting at which tm. use it as anneling tm for respective gene.

Dnt forget to check if your primer showing dimer.hairpin loop,internal loops etc. Strongly avoid this while designing primer

It can potentially hybridize with the template, but the PCR product will lose that nucleotide.

There should not be any problem, generally 3' end should not have the mismatch.

As everybody said, you should not have any problem. You may need to adjust annealing temperature but most probably it will work perfectly fine.

Good luck!

No Problem with your primer and the annealing temperature There is only an exception if the primer is designed as ASP-primer. Good Luck

I think it should work. Check the AT of the incorrect primer. You may need to reduce the AT by 1C or so in the PCR.

There will be no problem in PCR product. I think same annealing temp will work else you put gradient PCR to get perfect result. No need of ordering new primers. There are many software available for primer designing. Just Google for "primer designing"

All the best

It will definitely work as your normal primers.... a mismatch at 3' end will not give any amplification otherwise 60% mismatches other than at 3'end gives amplification by adjusting annealing temperature...

I have used some terrible published primers that break every rule of thumb in the past and they have worked at almost any temp you throw at them. I have also spent time designing the perfect primer sets too, only to spend weeks getting them to work. PCR is 10% expertise and 90% voodoo.

I cant see how the missing A will have any issue on your amplification. If you had completely different bases in the place of the A then it would still stand a chance. However, misspriming is more of an issue at the 3' end.

good luck

The miss match can some times work. this depends on the AT: CG ratio and the strengency condition of the PCR reaction

No problem here. Could be a different story if you wanted to prime there was an internal deletion or if you added instead a wrong base.

BTW, did you success in your PCR?

No problem，the PCR can work well.but the 3’ end of primer is good at other nucleotides G and C

Indeed, the product you will get is your target. Missing a nucleotide at the end is no big deal unless this set of primers with or without the missing nucleotide (at the end) are forming primer dimer or anneal to an off target! With these primers I would run my PCR at 55 degrees Celsius. Good luck.

one base substitution is not a problem, go ahead, the primer will anneal with the template.

No problem, it will work

This PCR should definitely work ever if the reverse primer has a missing nucleotide. Moreover, PCR protocols are very standard ones and just works if you have the right Tm and chemicals (buffer, enzymes etc). I would suggest you to run a temperature gradient whenever you run a PCR with new set of primers...Thanks.

yes i think that PCR should work and even if you don't change the anneling temperature but you can do withPCR primer online