PCR, Cloning, Restriction Digestion, Ligation, Transformation, Plasmid et al | Contact experts in Molecular Biology to get answers
1,860 views 3,277 posts
Questions related to Molecular Biology
Hello, I was running a PCR with various primer concentrations (I am aware that some of those concentrations are outrageously high). To my surprise the lowest primer concentration (200 nM) had a...
02 July 2024 2,863 4 View
Hi everyone! After thinking about it on my own, I'm posting a question here. Has anyone ever tried creating qPCR standard curve samples (plasmid or DNA standard) by inserting multiple target...
01 July 2024 1,514 1 View
I have used the same primers for amplification and have been fine, but suddenly I started getting smear in both my negative control and test. I have checked all my reagents and NFW by using the...
28 June 2024 7,642 5 View
Dear all, I am writing to explain my problem and would greatly appreciate any small hints that might help alleviate my desperation. I am relatively new to proteomics, and our laboratory has an old...
27 June 2024 9,898 10 View
Hi, I am working with Invitrogen Seamless cloning which requires 200 ng/ul insert DNA fragment. Protocol recommends to use restriction enzyme to digest pre-cloned plasmid and then elute specific...
26 June 2024 923 2 View
Hello, everyone. I would like ask one question. I transfected fibroblasts with EF1A-myod-puro using lipofectamine 3000. Promoter for puro is CMV. After transfection 48 hours, I did puromycin...
24 June 2024 4,855 3 View
Hello everyone, I am encountering an issue with normalizing my Western blot data and am seeking advice on the best normalization method to use. Context: I have performed several Western blots,...
22 June 2024 8,989 0 View
I wanted to check the expression of a transfected membrane protein called NET, so I decided to check the mRNA by RT-PCR. After three months of culture selection (the cells were still not...
19 June 2024 5,764 3 View
Hello, I have started working with Western blot recently and have difficulties getting the beta-actin band. I recently tried the steps for getting a beta-actin band from the intestinal sample of...
18 June 2024 3,701 4 View
Hello everyone, I am isolating PBMCs and stimulating them using different stimulation conditions. my question is, I want to add IL-2 to the medium for better viability after stimulation, Would you...
17 June 2024 888 1 View
Gostaria de saber se alguém teria este livro em pdf, o DOI ao qual tive acesso não gerou resultados.
12 June 2024 3,996 0 View
The primers size
30 May 2024 707 1 View
If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...
23 May 2024 7,721 1 View
Hi, I am trying to express Trypanothione synthetase a protein from Leishmania, cloned in pET28a vector and transformed in E.coli. BL21 (DE3). The size of the protein is 74kDa. Initially, I...
22 May 2024 4,653 5 View
The RH blood group system is encoded by RHD and RHCE genes, and the difference of G>C at the 676 base of exon 5 of RHCE gene represents the RHE and RHe alleles. If you want to design primers...
22 May 2024 7,612 1 View
I have been trying to get my PCR to work and amplify the correct region but can not figure out what is going on with it. I seemed to have nailed it down to something with the primers. One of the...
20 May 2024 5,033 5 View
Hi All, Our group is doing some flow cytometry assays using an HLA-A*0201 tetramer presenting an HBV peptide (FLLTRILTI) and we're getting some strange results... We ran tetramer flow on a bunch...
17 May 2024 8,071 1 View
My study is about assaying ACTH receptor (ACTHR/melanocortin-2R)distribution in the adrenal cortex of sheep. After extensive search of primary antibody catalogues, I could not find anyone stated...
16 May 2024 6,566 4 View
I did BLAST of the two cellulolytic species and one lignolytic species of bacteria after 16S amplification using PCR. However, my results indicate that the lignolytic organism is 100% similar to...
16 May 2024 4,438 8 View
Hello, I am making some plasmid constructs via Inverse PCR and T4 enzyme ligation. I started with a plasmid that housed nucleotide sequences for two fused proteins. My goal was to cut out the...
15 May 2024 3,185 3 View
I'm performing an antibody phage display with a VHH library and I consistently get frameshift mutants (mainly frame +2) after biopanning. I'm using TG-1 cells for amplification of phagemids and...
15 May 2024 354 2 View
Hello all, I want to immortalize human adult fibroblasts with a lentivirus plasmid containing hTERT under the promoter EF1A and puromycin resistance under the promotor mPGK. I performed a...
15 May 2024 6,793 3 View
The last couple of months I've been trying to replicate a small part of the DNA by using PCR. While everything was working great at first the PCR just stopped working one day. I haven't changed...
14 May 2024 2,790 3 View
Hello everyone. I have an issue with Western blot background when I use a higher percentage polyacrylamide gel during electrophoresis. The very same samples loaded into 10% gel lead to a very...
14 May 2024 8,223 4 View