Narayana Murthy Kada

8 Questions 8 Answers 0 Followers

Questions related from Narayana Murthy Kada

16S rRNA gene of bacteria is amplified but not able to sequence?

I was trying to sequence 16S rRNA gene of a bacteria. The gene is being amplified but unable to sequence it. Sequencing was attempted for 3 times but failed. What might be the reason?

28 May 2016 1,447 8 View

Does bacteria alter /adjust the pH of the liquid media itself while growing?

I have cultured a strain of marine bacteria in Nutrient Broth with 2% NaCl with pH adjusted between 2.0-10.0 in individual tubes to check the tolerance of bacteria towards various pH. After 48 hrs...

09 May 2016 1,034 15 View

In the attached Blast results sequence which is the best hit to be considered?

Please find the attachment of the Blast results of a sequence. I am unable to interpret the best identity among the results as the results give same Query %, E value and % identity with different...

19 November 2014 686 4 View

How can I extract compounds from bacterial agar plate?

Can anyone send me a reference on how to extract compounds from bacterial agar plate, as the particular bacteria shows the phenomenon only on agar plate.

11 May 2014 8,030 7 View

Does my PCR work with a nucleotide missing in the reverse primer sequence?

I had ordered primers for a PCR. Actual (correct) FW- CCTCTCTCGAACTCCGGAG RW- GTTGTGGAATTACTCGGAGGAA Ordered (incorrect) with a nucleotide 'A' missing at last of reverse primer FW-...

04 May 2014 4,442 61 View

Is the gene sequence coding of a particular enzyme same for all bacteria?

I would like to know if gene coding of a particular enzyme is same for all bacteria, that is, if the sequence of the gene of an enzyme is the same? For example, I would like to screen the...

03 October 2013 4,682 7 View

How to detect the bacterial enzymes?

Is it possible to detect bacterial enzymes by culture based methods? Can anyone share protocols for culture based methods to detect bacterial enzymes?

21 December 2012 4,095 34 View

How to revive marine bacteria which have became unculturable (VBNC)?

I am isolating vibrios from a marine source, a few of my strains are not able to grow again during subculture. Can anyone suggest methods to revive them?

25 July 2012 8,153 8 View