12 Questions 9 Answers 0 Followers
Questions related from Narayana Murthy Kada
I was trying to sequence 16S rRNA gene of a bacteria. The gene is being amplified but unable to sequence it. Sequencing was attempted for 3 times but failed. What might be the reason?
28 May 2016 1,619 8 View
I have cultured a strain of marine bacteria in Nutrient Broth with 2% NaCl with pH adjusted between 2.0-10.0 in individual tubes to check the tolerance of bacteria towards various pH. After 48 hrs...
09 May 2016 1,234 15 View
I would like to study the culturable bacterial diversity of mangrove rhizosphere. can any one suggest me some RAPD primers??
18 February 2016 7,662 0 View
Please find the attachment of the Blast results of a sequence. I am unable to interpret the best identity among the results as the results give same Query %, E value and % identity with different...
19 November 2014 781 4 View
Like toxR; are there any other virulence genes which are widely present among majority of the vibrios, which can be used as virulence markers to screen wide group of vibrio isolates?
20 October 2014 6,898 2 View
How to differentiate biosurfactants from bioemulsifiers practically. what are conclusions to derive from higher (>75%) emulsification index?
25 July 2014 3,754 4 View
Can anyone send me a reference on how to extract compounds from bacterial agar plate, as the particular bacteria shows the phenomenon only on agar plate.
11 May 2014 8,127 7 View
I had ordered primers for a PCR. Actual (correct) FW- CCTCTCTCGAACTCCGGAG RW- GTTGTGGAATTACTCGGAGGAA Ordered (incorrect) with a nucleotide 'A' missing at last of reverse primer FW-...
04 May 2014 4,541 61 View
Can Gram's iodine solution detect the polysaccharide, or is it compulsory to use Lugol's iodine solution?
13 November 2013 6,216 0 View
I would like to know if gene coding of a particular enzyme is same for all bacteria, that is, if the sequence of the gene of an enzyme is the same? For example, I would like to screen the...
03 October 2013 4,801 7 View
Is it possible to detect bacterial enzymes by culture based methods? Can anyone share protocols for culture based methods to detect bacterial enzymes?
21 December 2012 4,214 34 View
I am isolating vibrios from a marine source, a few of my strains are not able to grow again during subculture. Can anyone suggest methods to revive them?
25 July 2012 8,264 8 View