The introduction of DNA into a recipient eukaryote cell and its subsequent integration into the recipient cells chromosomal DNA. | Contact experts in Transfection to get answers
1,291 views 2,934 posts
Questions related to Transfection
Hi everyone, I am currently working on testing the effect of PolyIC stimulation on different cell lines. But I could not find any specific information on what to use as negative control. I am...
29 July 2021 9,413 2 View
Dear all I am trying to transfect my plasmid of interest in the mcf-7 cells by lipo3000 or calcium phosphate. but after botting observing multiple bands tried every possible condition, including...
27 July 2021 4,692 7 View
Protocols/suggestions are appreciated. Thanks. I need what is the ratio or the volume from siRNA with Lipofectamine 3000 to transfect in 96-well
26 July 2021 9,428 2 View
I am trying to transfect Hela cells with a large 12 kb plasmid by using Lipofectamine 2000. I have used various concentrations (1,2,3,4 and 5 ug) of the plasmid and transfection reagents but the...
25 July 2021 1,594 3 View
Generally CHO (DHFR -ve) cells on transfection with plasmid bearing DHFR gene + Gene of Interest and upon addition of MTX only thoose cells which take up plasmid (containing DHFR + Gene of...
22 July 2021 7,681 3 View
I am facing a problem with plasmid DNA transfection in the 3D hydrogel system. I am using a two-component hydrogel system, where you mix the Comp A and B at a definite ratio it forms a hydrogel....
22 July 2021 7,976 9 View
1) In the Freedom CHO-S kit user guide it was mentioned that CHO-S cells contain basal expression of DHFR, upon transfection how to distinguish b/n untransfected and transfected cells which take...
22 July 2021 5,923 0 View
hi, i am currently preform the siRNA transfection of ovcars cell with silentfect lipid reagent. kit protocol only said the gene silencing can be monitored at the mRNA or protein levels from 4 to...
21 July 2021 8,627 2 View
Hi! I'm currently working on establishing an in-vitro model for diabetes-research concerning DNA-methylation, and therefore I'm cultivating HepG2 and HEK293 cells at different glucose...
21 July 2021 4,586 2 View
Do you know of any cell line that has overexpressed nitroreductase? I am not interested in transfection. Thanks
20 July 2021 8,607 3 View
For the study, we have isolated a promoter sequence that has been ligated with Luciferase vector and transfected into the HeLa cells which are being incubated in different experimental conditions....
20 July 2021 5,373 3 View
Hi, guys, I want to study two genes' function in endothelial cells at the same time. I would like to use siRNA to knock down one gene and lentivirus to overexpress another gene. Do you have any...
19 July 2021 9,021 3 View
I am working with SH-SY5Y cells transfected with α-synuclein and I am studying the effects of glutamine on Parkinson's Disease progression. Since the cells are already transfected with the SNCA...
13 July 2021 2,814 3 View
I transfected a cell line with plasmids having shRNA inserts. After transfection, when should I examine the knockdown efficiency? I would like to isolate total RNA and do qPCR for that. I would be...
13 July 2021 6,289 3 View
I am currently expressing Fas ligand (secretory expression with signal peptide) from HEK293T cell line. I wanted to purify the protein afterwards using affinity chromatography. But I had...
12 July 2021 5,769 9 View
Dear Researchers, I'm going to transfect SH-SY5Y cells using lipofectamine 2000. The vector size is less than 10 kb. Please give me some technical advises to increase the transfection rate. Regards
11 July 2021 9,988 1 View
I'm working on a certain protein (protein A). It has been constructed on a plasmid, and two point mutations have been created (WT and mutant 1 and 2). After transfecting cells with equal amounts...
09 July 2021 1,941 10 View
I have seen in many articles for cellular uptake, AuNps-DNA coated were added directly to the cell culture media and get incubated for a specefic time. However, In some other articles, people use...
09 July 2021 6,431 2 View
Extraction by phenol chloroform isoamyl alcohol
09 July 2021 5,451 3 View
i am currently struggling to transfect c2c12 cells for transient expression if anyone have efficacious protocol for c2c12 transfection . thank you
08 July 2021 6,324 1 View
I constructed overexpression plasmids of Class I MHC molecules (HLA-I), with C-terminal Myc-FLAG tag or GFP-tag. I transfect the plasmids in 293T cells to test expression. The expression can be...
02 July 2021 4,320 1 View
Hi! I have a stable TCR transfected cell line but I realized I should also express CD8 alpha and beta chains in order to properly test antigen response. One option is to go back to plasmid...
02 July 2021 4,162 4 View
Hello, I am looking for a starting place for protocols for pdDNA 4 and 6. I found that pcDNA6 can generally follow the manufacturers protocol, but I was not sure how to take on pdDNA4. Any help is...
01 July 2021 4,252 2 View
Hi, I'm trying to do a base editing. My target gene is MYBBP3A, the guide RNA I'm using is ACTCGCGACTGTGCTTCAAT and I cloned it in the pLentiguide-puro (Addgene 52963). I used this guide because...
28 June 2021 2,120 7 View