The introduction of DNA into a recipient eukaryote cell and its subsequent integration into the recipient cells chromosomal DNA. | Contact experts in Transfection to get answers
1,299 views 2,934 posts
Questions related to Transfection
This is probably a dumb question, but what is the purpose for adding an n terminal secretion peptide to my protein insert during transfection into mammalian cells? Why would I want the protein...
01 September 2021 1,450 3 View
Hi all, I am transfecting HEK293T cells with SARS-Cov-2 spike protein. I will likely be transfecting the entire sequence after I clone my insert into my plasmid. However, most publications do not...
01 September 2021 4,628 2 View
I have been trying to stably knockdown a gene in mammalian cells using viral supernatant from HEK293FT cells. Although I have found transfection efficiency to be good enough multiple times, after...
28 August 2021 7,050 1 View
Hi everyone, I would like to know if the agrobacterium cells can be stored after their transformation with the plasmid of interest for future plant transfection via agroinfiltration. If the answer...
27 August 2021 5,410 3 View
I am trying to generate a stable cell line by transfecting MCF-7 cells with Lipofectamine 2000. The protein is expressed in transient transfection with 20% efficiency. However, after adding the...
27 August 2021 1,989 3 View
I would like to transitory transfect ASC52telo to introduce plasmids for GFP-crispr editing, I tried several liposome derived samples but the efficiency is very bad, does anybody expericence with...
27 August 2021 8,277 3 View
I am utilizing a pcDNA3.1 vector and gibson assembly to insert my gene of interest into HEK293T cells using lipid based transfection. I am doing some optimization with a control vector that...
27 August 2021 3,097 3 View
Hello everyone! We bought the TOPO™ TA Cloning™ Kit for Sequencing, with One Shot™ Mach1™ T1 Phage-Resistant Chemically Competent E. coli from ThermoFisher. Unfortunately, the competent E. Coli...
27 August 2021 1,640 2 View
Hi, I used MaxQuant to perform label-free protein quantification, and enabled the 'match-between-runs' feature. When I ran the output txt files in Proteomics QC (PTXQC) software I can see that...
26 August 2021 5,559 2 View
I have been using Polyethylenimine (PEI) transfection reagent and pCDH/ VSV-G lentviral vector, the transfection results is not successful. When I transfect HIV-1gp120/160 by using PEI reagent...
25 August 2021 2,057 3 View
Hello, I performed a single digestion on my plasmids (~6.5kb) using BamHI. The total reaction volume was 10µl (containing 0.5µl(10U) BamHI) and the samples were incubated at 37° for 1hr. After...
25 August 2021 7,254 3 View
Hello everyone I have never cultured cells in my life and everything is new to me. I've done some tests with Lipofectamine® 2000 in my IMR-32 cell line with some plasmids containing dTomato that...
20 August 2021 7,349 7 View
I'm conducting a Puromycin dihydrochloride antibiotic selection in CHO cells, according to several protocols, the medium is replaced with fresh medium containing Puromycin every 48 hrs, in order...
19 August 2021 5,824 4 View
Why my BrdU staining shows so many false positive? My protocol was: The hippocampal slices were rinsed with 0.05 M Trisbuffer (TB) incubated for 5 min at room temperature with 0.3% H2O2, denatured...
17 August 2021 8,822 3 View
I need to transfect some plasmids in the HLEB3 cell line but I do not find evidence that this was tried, apart from the transfection of SV40 T antigen in primary HLE cells. If anyone has done...
14 August 2021 249 3 View
I have been trying to transfect P-cadherin GFP plasmids into previously generated knockout MCF10A cells (passage no. ~40) but have not been able to get the cells to show GFP. I use NEON...
12 August 2021 1,788 3 View
Dear all: I replace the sp6 promoter sequence (ATTTAGGTGACACTATAG) by T7 (TAATACGACTCACTATAGGG), after I transfected IVT mRNA into 293T cells, very fewer EGFP positive cells in T7 IVT mRNA...
05 August 2021 6,929 2 View
I am trying to transiently co-transfect dCas9, gRNAs, and a puromycin-resistance plasmid into A549 cells using Lipofectamine 3000, but I see almost complete cell death by 4 days post-transfection...
05 August 2021 453 3 View
I recently conducted a maxiprep of a plasmid of interest. No major issues for the majority of the prep, the only strange thing occurred after the elution when I noticed the color of the final...
03 August 2021 5,948 5 View
I want to analyze the iron nanoparticles I synthesized using DLS and zeta potential methods. I did that analyze before, but this time I want to do DNA-binded nanoparticles. I read a few papers...
03 August 2021 4,724 3 View
Hi, I'm working on C2C12 myotube differentiation using DMEM (Horse Serum 2% and PEST 1%) and I've noticed that the cell culture looks really dirty. Here's my picture of c2c12 on day 3 of...
03 August 2021 3,943 1 View
I am trying to transfect primary cells- mesenchymal stem cells using lipofectamine RNAiMAX. For its standardization I'm using a scrambled siRNA which is FITC tagged in order to come down to a set...
02 August 2021 8,937 0 View
Hi All I have a technical question regarding the transfection control. For the WT control (where we use the parent plasmid for cloning) Should i make a PCR reaction for it , transformation ,...
30 July 2021 7,945 3 View
HI I am transfecting my DNA into HEK293T cells . The WT cells (which has the plasmid used for cloning) do not show the flag when WB was done , while it was expressing in the mutant i made. Can...
29 July 2021 5,325 3 View