Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a... | Contact experts in Plasmids to get answers
2,709 views 5,266 posts
Questions related to Plasmids
this primer and probe are specific to the mthfr gene (C677T) AGGCCAGCCTCTCCTGACTG AGGACGGTGCGGTGAGAGTG Taq man probe: CGGGAGCCGATTTCATCA—FL 640-CGCAGCTTTTCTTTGAGGCTGACA—PH
04 June 2024 258 2 View
Hello, everyone. While transfecting my cells with plasmid, I noticed this overnight; normally, my cells are adherent (as seen in the background); I'd like to know if anyone else has seen this...
04 June 2024 238 4 View
I am working with temperature, precipitation data (0.1 degree from CDS store) and population density data (2.5 min from SEDAC) and often have to change the resolution of either data to achieve a...
30 May 2024 9,678 2 View
I am expressing an mCherry tagged protein. Yield of total protein is good but the fluorescence intensity is very low (ie. Protein assays and gels show a lot of protein but this does not correspond...
29 May 2024 4,844 1 View
My research group has samples of plant tissue that were pulverized in ln2 using a mortar and pestle before being weighed into tubes and stored in RNAlater at -20 degrees for a few months before...
29 May 2024 7,302 0 View
I'm trying to stain areas of dystrophic calcification in sections of FFPE perinatal brain tissue. Typical basophilic appearance on H&E but nothing with Alizarin Red (costochondral junction...
29 May 2024 4,091 2 View
Being a Ph.D. Scholar, I am seeking funding sources that offer financial assistance for conference registration and travel expenses to attend international conferences, specifically those held...
27 May 2024 729 2 View
Navigating the Post-ICU Journey: A Holistic Approach to Reco... What are the long-term outcomes for ICU survivors who receive comprehensive post-ICU care compared to those who do not?
26 May 2024 8,025 2 View
Understanding and Managing Constipation: A Comprehensive Rev... What are some important considerations in the management of pediatric constipation?
25 May 2024 7,806 2 View
Advancements in Hemodynamic Monitoring: A Comprehensive Exploration What are some potential risks associated with relying solely on non-calibrated hemodynamic monitoring techniques in...
23 May 2024 3,068 1 View
I have been trying insert my reporter construct (1.8kb - taken from another plasmid) into my lentiviral vector (9.6kb). They have compatible restriction sites - NheI and EcoRI. I digested the...
22 May 2024 7,337 1 View
I am planning to purify the mononucleosome for cryoEM study. I have seen, people assemble the nucleosome from recombinantly expressed histones and then providing DNA sequence to it. Isn't this...
20 May 2024 7,190 1 View
Today, the most commonly used techniques for assessing the concentration of EV samples are NTA and the determination of total protein concentration. However, the concentration obtained by NTA...
17 May 2024 6,930 1 View
How does an LCR meter works? When we measure capacitance with an LCR meter in series or parallel mode, what do series or parallel mean in this context? What components are in series or parallel?
17 May 2024 842 0 View
I am doing my undergrad thesis that requires me to do PCR-RFLP analysis on DNA that I extracted from some blood samples. Initially, I was using the Qiagen mastermix for the optimization of my...
15 May 2024 4,390 4 View
As the title described, it is common that a target gene sequence contains motif that acts as the binding site of transcription factor rather then the upstream regulatory region. Does this affect...
14 May 2024 1,130 3 View
Swin-Transformer transform the image to tokens to input to transformer. Is each token (before-embedding) value an integer? In practice, where is this done?...
14 May 2024 1,141 2 View
Are review articles/papers considered inferior and undervalued in academic research?
14 May 2024 264 3 View
Optimizing Management Strategies for Septic Shock: A Multidi... What are the prognostic factors associated with septic shock outcomes?
13 May 2024 6,653 1 View
Optimizing Antibiotic Use: The Role of Antimicrobial Steward... Optimizing Antibiotic Use: Strategies and Challenges in Anti... What role do pharmacists play in antimicrobial stewardship, and...
13 May 2024 3,408 1 View
We have dozens of pure fungal strains recovered from the soil and need to know the extent of their ability to produce antibiotics. Still, the problem is the spread of fungal mycelia on the plate...
10 May 2024 9,482 2 View
I am starting out on some siRNA based knockdowns on primary cells. Would anyone recommend good services they have used in India and any advice considering the advantage of modified and fluorophore...
10 May 2024 6,457 0 View
En México existe una institución externa a la universidades que evalua a los candidatos al egreso, es decir, a los alumnos que se van a graduar de licenciatura. Es una prueba a gran escala, que...
09 May 2024 6,694 1 View
We’ve got this generation of boys growing up thinking that, you know, women practically faint at the sight of an erection, that women orgasm through penetration, that threesomes are normal....
01 May 2024 6,058 7 View