Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a... | Contact experts in Plasmids to get answers
3,448 views 5,889 posts
Questions related to Plasmids
I'm comparing protein abundance in different disease/symptomatic states using R and correcting for multiple testing using the built-in BH method like this: SymptomStatus_p.value =...
16 September 2024 3,833 1 View
I have selected the step explicit dynamic temperature displacement analysis in ABAQUS, and I have given the predefined temperature field to the sheet surface and the tool reference point. when I...
04 September 2024 6,057 0 View
What is the reason of smeared fainted band in gel electrophoresis of DNA.
03 September 2024 7,212 3 View
Hi I am making some rTaq by e.coli for our routine genotyping PCR. rTaq purified in house has a concentration unit of ug/ul instead of U/uL which is commonly used by commercial suppliers. We do...
28 August 2024 9,911 2 View
Do you think it is possible to make this thing? Please attach your answer with some sources if possible.
27 August 2024 3,869 4 View
I was given neutron tomograms of plant roots. I don't want to analyze them manually, whether they are different or not. For example, counting the number of nodes myself would be problematic. I saw...
26 August 2024 7,058 2 View
At the moment I'm struggling with the documentation of my labs cell culture work, and would be happy to hear some suggestions. I've established an excel table that I though is easy to use and...
19 August 2024 7,237 2 View
I am working on yeast transformation of a calcium channel. I performed twice transformation and no colony was observed after 3 days. The transformation protocol works well before. Is this gene...
15 August 2024 2,842 1 View
Hello. Firstly, I installed Autodock with autodocksuite-4.2.6.i86Windows.exe. Then I tried to install MGL Tools with mgltools_win32_1.5.7_Setup.exe, but an error occured in the end. If I close...
14 August 2024 4,190 2 View
Hello all, I am trying to determine the dependence of the energy gap of silicon as a function of temperature. In the literature, it is stated that the decrease in the energy gap of silicon with...
13 August 2024 7,876 2 View
Hello I am doing multiplex PCR for SCCmec typing of MRSA, but I am not able to get a band which is 1791bp and it is the largest band while all other five bands are present as intended. I used DNA...
13 August 2024 1,237 7 View
Hello, I am developing a quantitative method using HPLC-ESI-MS (ion trap mass spectrometry) in the negative ionization mode. I face an issue but I cannot tell why it is happening. I inject the...
08 August 2024 8,307 0 View
Hello everybody, I'm struggling a lot with my RNA dot blots to detect m5c level. Briefly the protocol I followed (based on this paper"Protocol to analyze the role of various metabolites in...
23 July 2024 6,547 2 View
I'm going to insert DNA fragment into 'junk DNA' (non-transcribed, non-regulatory DNA region). Although the target sites are junk DNA, it's intuitively obvious that the larger the size of...
16 July 2024 5,404 1 View
Hi everyone, I'm currently working on a molecular dynamics (MD) simulation project where I'm investigating the behavior of vacancies and interstitials generated by displacement cascades. I'm...
12 July 2024 1,371 0 View
Hi all, would be grateful of some advice with regards to suitable statistical analysis for a study with repeated measures taken from the same subject. The study revolves around repeated heart...
08 July 2024 4,235 1 View
Hi, I want to load TMZ drug into extracellular vesicles (Exosomes) using incubation and sonication. I'm still stuck doing the incubation one. For the method, I mixed the TMZ and exosomes in the...
08 July 2024 9,991 0 View
I am calculating MD simulation of the system using following keywords: %mem=1400MB # wb97xd/6-31g(d) geom=(connectivity,crowd) admp=(maxpoints=4000,fullscf) integral=ultrafine...
07 July 2024 3,732 0 View
I use the psip-403 vector that contains the erythromycin resistance gene for cloning, and I also tested several strains of Escherichia coli bacteria (top10f, dh5 alpha) for this purpose, and the...
06 July 2024 8,953 3 View
Hi there, Recently I've been exhausted with my EMSA, I'd appreciate it if anyone could offer me some advice. Please see the attachment for detailed information, and here are my questions: 1, I'm...
05 July 2024 5,429 4 View
Cloud computing is a model for delivering computing services over the internet (the cloud) instead of maintaining servers and software locally. These services include cloud storage, data analysis,...
22 June 2024 4,786 0 View
Tissue needs to be cut to weigh the desired amount for Trizol homogenisation
06 June 2024 1,862 0 View
this primer and probe are specific to the mthfr gene (C677T) AGGCCAGCCTCTCCTGACTG AGGACGGTGCGGTGAGAGTG Taq man probe: CGGGAGCCGATTTCATCA—FL 640-CGCAGCTTTTCTTTGAGGCTGACA—PH
04 June 2024 316 2 View
Hello, everyone. While transfecting my cells with plasmid, I noticed this overnight; normally, my cells are adherent (as seen in the background); I'd like to know if anyone else has seen this...
04 June 2024 329 4 View