Contact experts in Annealing to get answers
2,589 views 670 posts
Questions related to Annealing
Hello everyone! I got a similar query! I have calculated Tm for my primers and those were in the range of 58-62. However, when I received from the company, those were in 53-58 range. And now the...
26 August 2020 5,338 8 View
Hi dear colleagues, I am fabricating an organic photovoltaic device with the structure ITO/PEDOT: PSS/ P3HT: PC70BM/ Al, and the obtained IV relationship was found to be linear rather than...
20 August 2020 5,068 5 View
Hello everyone! I need to etch Si to the depth of 1mm approximately, not affecting the surface of the sample (which is atomically flat and must be kept as it is, so we can't anneal the sample)....
17 August 2020 9,831 1 View
I am trying to sequence a potential KO by submitting samples to Genewiz, and I am getting this repeat in one of my sequences. Here is my PCR Steps -98 degrees for 2 minutes -Touchdown 7 times...
13 August 2020 606 3 View
I want to dissolve bathcuproine in methanol and to prepare thin film on substrate.Is annealing necessary for this? and after dissolving how long time i will wait for the solution?what will be...
22 July 2020 6,122 3 View
Hello Research Community, We are right in the middle of research on picking US stocks with the help of a quantum annealing quantum computer. We are thinking about forking our research and...
15 July 2020 3,178 3 View
Hi I observed many cracks generated during 1h solution annealing at 1100 ̊C followed by 8h aging at 700 ̊C and air cooling between stages of the L-PBF Inconel 625. What would be the reason for...
19 June 2020 2,775 5 View
Hi all, I wish to understand why doesn't all polymerase can detect a single copy of region of interest? While some polymerase is more sensitive (like dreamtaq), and some are less sensitive, what...
03 June 2020 4,505 21 View
Dear all, I would like to simulate a double step hydroforming process with Abaqus software. In this method, the sheet will be hydroformed during one step and then this sample will be annealed....
02 June 2020 1,453 3 View
I have been in discussion with my colleague about the fabrication of PSCs with CH3NH3PbI3-xClx absorber material and there is a claim that chlorine dopant sublimes during annealing. If anyone has...
26 May 2020 1,158 4 View
Hello, I need to change two adjacent nucleotides. * I've added 5% DMSO * I've used an annealing temp that is 5 degrees higher than the tm of the primers. * Im using a hot start kit But after...
14 May 2020 936 3 View
What is the best temperature for annealing such film.I am going to use it for photo voltaic applications.
13 April 2020 6,579 4 View
i have deposited tio2 thin film in glass substrate by spin coating technique.Now I want to anneal it so can anybody tell me what is the best temperature for annealing such film.I am going to use...
04 April 2020 4,038 5 View
Since there is complete lock down in my state and city I cant go for annealing in my lab. So can anyone suggest me some other method (other than muffle furnace/oven) to anneal a thin film...
01 April 2020 6,979 4 View
I am depositing TiO2 thin film onto glass/FTO using spin coating technique.I am using 2gm of TiO2 powder,8ml ethanol,2 ml acetyl actone and 1ml titanium isopropoxide.The solution is stirred for 8...
01 April 2020 6,069 11 View
Hello everyone, I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this...
26 March 2020 680 5 View
I've heard mention that annealing PEDOT:PSS film a second time after completely drying the coating, helps achieve better results. Is this true? Are there any publications available that support this?
19 March 2020 1,206 3 View
During my tests I have observed that even after cooling to room temperature after annealing, the characteristics of the thin film (conductivity etc.) seem to be in flux. They only stabilize around...
19 March 2020 8,739 3 View
I am trying to draw band bending at Si-SiO2 interfaces due to doping and anneal effects
18 March 2020 7,494 5 View
In OE PCR, I have to stitch two gene sequences, so the annealing temperature in the first cycle would depend on the overlap reagion between two products designed with appropriate primers or would...
15 March 2020 2,800 3 View
I'm trying to transfer graphene film with the traditional bubbeling method. My graphene is deposited on Cr + Pt substrate, I recovered sample with PMMA (using spin coater 4000 rpm and a short 3...
09 March 2020 6,672 8 View
I am trying to anneal the NiO thinfilm which is cotted above on Ag film.When ever i anneal the multilayer film the Ag film becomes disappear.
06 March 2020 4,427 5 View
Which photoresist is good for the planarization of the PEN plastic substrate? because my PEN has many scratches I want to make to smooth film for the device fabrication. it would be great if you...
03 March 2020 7,440 3 View
Temperature of annealing= 300- 450 degree Soaking time= 1 hr Solution treated condition= T4 Any chances of artificial aging in 1 hr soaking time?
28 February 2020 5,518 3 View