Hello everyone,
I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this primer (5' CTTCGCTAGAGGCGTGGCCAG 3') with the last three "GGG" missing. Will that cause a problem in the further downstream process of gRNA cloning into the vector of choice? Any feedback would be appreciated.
Thanks and regards,
Ramesh Kumar
Hi
The important section of the oligos sequence for your gene of interest is usually approximately in the first 20 amino acids of the 5 'region. In this case, if your initial sequence of those 20 amino acids in the 5´-3´ direction is correct, I do not think there is a major problem, since it is possible that the fragment of your oligo is sufficient for successful recognition.
Should be ok, you could do a check on Primer-Blast to see if there is any other potential non-specific binding
A 21 bp primer should be long enough to still be specific to your gene of interest, as others said, BLAST it for specificity. Shortening a primer might change it's annealing temp, you might want to try a gradient PCR to be sure.
Out of curiosity, why did you shorten your primer?
Katie A Burnette - I made a blunder while ordering the primers.
- Badges
- Science topic
- Similar topics
- Engineering
- Materials Engineering
- Annealing