Hello everyone,

I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this primer (5' CTTCGCTAGAGGCGTGGCCAG 3') with the last three "GGG" missing. Will that cause a problem in the further downstream process of gRNA cloning into the vector of choice? Any feedback would be appreciated.

Thanks and regards,

Ramesh Kumar

More Ramesh Kumar Krishnan's questions See All
Similar questions and discussions