35 Questions 48 Answers 0 Followers
Questions related from Sakthivel Govindaraj
How to fix the sample size for human questionnaire study
07 July 2019 4,728 6 View
Dear all, How circadian rhythm change and sleep deprivation affects the brain? does both acts deferentially or same way on the brain and what are the consequences? which has more negative...
12 December 2017 8,598 5 View
Hello Dear Friends, I have experienced a problem in the pAKT protein expression, it shows white color band. I have used recently purchased santa cruz antibody, primary antibody...
03 March 2017 1,265 5 View
Hello to everyone I am working in the field of stress physiology, I am comparing different parameters between Male animals Vs Female animals and within Male and female animals, each group contains...
10 October 2016 630 2 View
Dear all! I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence Forward primer AGAAGAGGACACAGATGGCTTTGT Reverse...
09 September 2016 4,092 5 View
Hello everyone!!! I have gone through a protocol for the estimation of 11 beta HSD1 from rat by ELIZA kit method, in that they mentioned that can use tissue homogenates and other...
09 September 2016 10,020 1 View
Hello to everybody!!! I have conducted a questionnaire-based survey study on how prenatal stress linked with offspring's autism spectrum disorder (ASD). I have two groups, I)...
06 June 2016 6,254 3 View
I am working with HPLC with ECD detector for neurotransmitter estimation from rat brain homogenate.. Few days back when i was doing HPLC, the base line reached from 2.5mV to around 1000 mV...
02 February 2016 2,003 7 View
I am working in less established lab with lack of funding from india. I am doing Neurotransmitters estimation from rat brain homogenate. if anyone provide me 10-20mg of glutamate HPLC standard it...
02 February 2016 5,936 0 View
Hello to everyone!!! I am doing animal behaviour and biochemical analysis for my studies, i have four groups control and three different stress groups. For my study i...
11 November 2015 10,197 4 View
How to quantify the homocysteine levels in the brain tissue, please give me procedure for estimation of homocysteine..
03 March 2015 1,341 2 View
How maternal stressful condition affects offspring's cognitive ability and behavior alteration? and what is the molecular mechanism involving this cognitive impairment?
02 February 2015 9,107 4 View
Can anyone provide me protocol for Vitamin D estimation from animal brain tissue.
01 January 2015 3,838 2 View
What kind of work can be published in short communication and letters? how it differs from research article?
12 December 2014 2,850 0 View
In some studies they used sodium valproate and some studies they used valproic acid, so which is the more appropriate chemical compound to induced autism in rat? WIll all the offspring have the...
11 November 2014 8,293 3 View
If we are human and with six senses this has happened because of Evolutionary mutation know? Is that good for betterment of living things or bad? it may be the reason to reach the next level?
10 October 2014 4,015 1 View
How immobilization stress cause the psychological stress in animals and what is the mechanism behind that?
10 October 2014 5,781 3 View
can any one suggest me what are the special stains available for brain specific and its staining pattern. Thanks in advance for your valuable time spending
09 September 2014 4,972 3 View
Learning new things during gestational period how will influence on offspring and what would the possible mechanism of passage of this same information from mother to offspring? Learning new...
09 September 2014 6,439 3 View
What is the relationship between visual perception and stress, anxiety? What is the mechanism visual perception causes the these effects?
09 September 2014 2,954 16 View
Memory is genetically regulated from mother to offspring or its all influence by her experiences during gestational period. What influences or what determines the offspring cognitive process and...
09 September 2014 9,711 9 View
If one trained an animal to a particular behavioral experiment, that same animal can use it for learning another experiment. I am not going to do any behavioral assessment in the same animal just...
09 September 2014 9,978 10 View
EEG recording involves major methodology in my PhD thesis research, but I don't know how to analyse and interpret the result using MATLAB or any other software. If anyone works in this in India,...
08 August 2014 5,006 3 View
Does molecular weight determine the size of the particle? What is the correlation between molecular weight and size of the particle? Suppose molecular weight of the compound is approximately MW...
08 August 2014 9,369 4 View
I have recorded the EEG signals in rat, I have got only two waves one is parietal and occipital waves. Is it good enough to analyze and interpret only with these two waves? how to analyse these data?
08 August 2014 1,182 5 View
Is there any relationship between visual perception and anxiety/stress? some times while seeing some things or crowd of people or in the stage in front of audience we feel stressed or nervous and...
08 August 2014 3,786 1 View
Hi.. I have encounter a problem in histology tissue sectioning.. tissue processing is good and section also is coming properly but the problem is after drying the section alone coming out from the...
08 August 2014 8,964 28 View
How to record the event related potential (ERP) in a rat when it is anesthetized? Is it possible to record?
08 August 2014 8,692 3 View
Whether Dieckol is water soluble or lipid soluble and how much percentage?
07 July 2014 363 2 View
What is the reason that replication will takes place 5'-3' prime end?
07 July 2014 9,920 0 View
I have files which is EEG file format, if load these files in EEGLAB it shows some options like trail range subset, type range subset, electrode subset, response range subset, i don't what to have...
07 July 2014 3,622 5 View
What is the storage temperature for neurotransmitter estimation in HPLC? I freshly prepared and loaded it, it has separated very nicely, but the same sample I stored at -20C for six hours after I...
07 July 2014 7,774 1 View
I need some clarification about what is difference and specification of Wistar Albino, Sprague Dawley and Long Evans in the general as well as neurobiology aspects. How to differentiate wistar...
07 July 2014 2,174 10 View
Is it possible to deliver the nanoparticles size of 100-200nm intranasally into the brain to a rat? Is there any size range particular to intranasal drug administration?
06 June 2014 6,541 1 View
What is an appropriate homogenizing buffer medium for rat brain tissue for all kinds of experiments i.e. biochemical parameters, protein extraction?
06 June 2014 7,684 3 View