How to estimate the Homocysteine levels in Brain?

More Sakthivel Govindaraj's questions See All

How to fix the sample size for human questionnaire study? Is there any formula to fix the sample size in human study?

How to fix the sample size for human questionnaire study

06 July 2019 4,640 6 View

Does circadian rhythm change and sleep deprivation deferentially affects the brain? which is having more adverse effects?

Dear all, How circadian rhythm change and sleep deprivation affects the brain? does both acts deferentially or same way on the brain and what are the consequences? which has more negative...

11 December 2017 8,546 5 View

Does anyone have experienced the white band pattern in western blot technique for phosphorylated form of AKT protein expression?

Hello Dear Friends, I have experienced a problem in the pAKT protein expression, it shows white color band. I have used recently purchased santa cruz antibody, primary antibody...

02 March 2017 1,195 5 View

How to do Two-way ANOVA in SPSS for four groups and comparing between two different time points within the groups and between the groups?

Hello to everyone I am working in the field of stress physiology, I am comparing different parameters between Male animals Vs Female animals and within Male and female animals, each group contains...

09 October 2016 580 2 View

Is there anyone have experienced estimation of 11 beta hydroxysteriod dehydrogenase (11HSD1 b) from rat plasma samples?

Hello everyone!!! I have gone through a protocol for the estimation of 11 beta HSD1 from rat by ELIZA kit method, in that they mentioned that can use tissue homogenates and other...

08 September 2016 9,947 1 View

Why gene expression was not observed in real-time qPCR but it was observed in conventional PCR?

Dear all! I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence Forward primer AGAAGAGGACACAGATGGCTTTGT Reverse...

08 September 2016 4,018 5 View

How to select the appropriate statistical method for Questionnaire based survey study?

Hello to everybody!!! I have conducted a questionnaire-based survey study on how prenatal stress linked with offspring's autism spectrum disorder (ASD). I have two groups, I)...

05 June 2016 6,204 3 View

Why and what would be the reason for HPLC-ECD detector showing out of range?

I am working with HPLC with ECD detector for neurotransmitter estimation from rat brain homogenate.. Few days back when i was doing HPLC, the base line reached from 2.5mV to around 1000 mV...

01 February 2016 1,915 7 View

Can anyone provide me Glutamate neurotransmitter (HPLC standard) for research purpose?

I am working in less established lab with lack of funding from india. I am doing Neurotransmitters estimation from rat brain homogenate. if anyone provide me 10-20mg of glutamate HPLC standard it...

01 February 2016 5,892 0 View

How do I choose the appropriate statistics test and post hoc analysis for animal behaviour analysis?

Hello to everyone!!! I am doing animal behaviour and biochemical analysis for my studies, i have four groups control and three different stress groups. For my study i...

10 November 2015 10,120 4 View

Which type of compound does lamda max of 218 indicate in a uv-vis spectrum of a partially purified compound through column and TLC?

A crude extract of fungal culture using EtOH was subjected to column and TLC and partially purified compound was obtained. UV vis spectrum of the compound/s has max absorbance at 218nm. The...

11 August 2024 9,801 2 View

Can you connect an HPLC to a Mass Spec only at a certain time point?

Can anyone explain this method? Especially the last statement where it says only at 1.5 to 2.5mins was the MS/MS connected to the UPLC. How is that possible, is it a feature in this specific...

11 August 2024 8,141 3 View

GC-MS retention index prediticon?

Hello experts, Does anyone know any free software about retention index prediction ?

08 August 2024 7,403 2 View

Can I use a HisTRAP column for affinity chromatography?

I'm working on selecting antibodies against a recombinant protein that has a His-tag. My idea is to first bind the recombinant protein to a HisTRAP column and then use this column for an affinity...

07 August 2024 505 3 View

Separation of organic acids-HPLC?

Hello What should be done to separate and identify organic acids in HPC when their RetTime is the same?Like oxalic acid with Propanoic Acid.or acids that have a very close RetTime.

07 August 2024 8,782 3 View

Why is electronic energy 0.000 for liquid crystal compounds and is invariable with temperature in Guassian 09 software?

Are there any suggestions or insights you can provide to help address this problem

06 August 2024 1,443 2 View

RNA later for the preservation of RNA in fecal samples at room temperature for one day (37°C)?

I am planning to collect human fecal samples for metatranscriptomic analysis using MGI. These samples are from indigenous people living in a region with high temperatures. I will have access to a...

06 August 2024 1,367 3 View

Determining the worth of a point improvement in Hamilton Depression Scale?

Dear readers, Thanks for your attention. I am wondering about the health economic problem of quantifying the value of interventions which a) prevent, b) improve symptom profile and c) ultimately...

05 August 2024 3,246 1 View

The Curse of Evolution and Complexity?

Brain and body mass together are positively correlated with lifespan (Hofman 1993). The duration of neural development is one of the best predictors of brain size, and conception is the best...

05 August 2024 6,247 3 View

ANY free software for reconstructing neurons in the microscopic image?

Hi everyone, I am working on brain slices for visualizing a protein in the soma and dendrites, using a fluorescence tag. However, I need a tool (not paid) for reconstruction of the whole neuron,...

04 August 2024 4,725 2 View

Marina Mastelaro de Rezende

Hello,

I used an adjusted HPLC protocol, described by Pfeiffer.

Maybe these references can help you:

Pfeiffer CM, Huff DL, Gunter EW. Rapid and accurate HPLC assay for plasma

total homocysteine and cysteine in a clinical laboratory setting. Clin Chem. 1999

Feb;45(2):290-2. PubMed PMID: 9931056.

de Rezende MM, D'Almeida V. Central and systemic responses to

methionine-induced hyperhomocysteinemia in mice. PLoS One. 2014 Aug

25;9(8):e105704. doi: 10.1371/journal.pone.0105704. eCollection 2014. PubMed

PMID: 25153079; PubMed Central PMCID: PMC4143291.

Sincerely,

Marina M de Rezende.

How to estimate the Homocysteine levels in Brain??. Available from: https://www.researchgate.net/post/How_to_estimate_the_Homocysteine_levels_in_Brain#55102239cf57d78f4b8b46da [accessed Mar 23, 2015].

Sakthivel Govindaraj

Thank you so much madam for your help...