What is the solubility of Dieckol?

More Sakthivel Govindaraj's questions See All

How to fix the sample size for human questionnaire study? Is there any formula to fix the sample size in human study?

How to fix the sample size for human questionnaire study

06 July 2019 4,640 6 View

Does circadian rhythm change and sleep deprivation deferentially affects the brain? which is having more adverse effects?

Dear all, How circadian rhythm change and sleep deprivation affects the brain? does both acts deferentially or same way on the brain and what are the consequences? which has more negative...

11 December 2017 8,546 5 View

Does anyone have experienced the white band pattern in western blot technique for phosphorylated form of AKT protein expression?

Hello Dear Friends, I have experienced a problem in the pAKT protein expression, it shows white color band. I have used recently purchased santa cruz antibody, primary antibody...

02 March 2017 1,195 5 View

How to do Two-way ANOVA in SPSS for four groups and comparing between two different time points within the groups and between the groups?

Hello to everyone I am working in the field of stress physiology, I am comparing different parameters between Male animals Vs Female animals and within Male and female animals, each group contains...

09 October 2016 580 2 View

Is there anyone have experienced estimation of 11 beta hydroxysteriod dehydrogenase (11HSD1 b) from rat plasma samples?

Hello everyone!!! I have gone through a protocol for the estimation of 11 beta HSD1 from rat by ELIZA kit method, in that they mentioned that can use tissue homogenates and other...

08 September 2016 9,947 1 View

Why gene expression was not observed in real-time qPCR but it was observed in conventional PCR?

Dear all! I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence Forward primer AGAAGAGGACACAGATGGCTTTGT Reverse...

08 September 2016 4,018 5 View

How to select the appropriate statistical method for Questionnaire based survey study?

Hello to everybody!!! I have conducted a questionnaire-based survey study on how prenatal stress linked with offspring's autism spectrum disorder (ASD). I have two groups, I)...

05 June 2016 6,204 3 View

Why and what would be the reason for HPLC-ECD detector showing out of range?

I am working with HPLC with ECD detector for neurotransmitter estimation from rat brain homogenate.. Few days back when i was doing HPLC, the base line reached from 2.5mV to around 1000 mV...

01 February 2016 1,915 7 View

Can anyone provide me Glutamate neurotransmitter (HPLC standard) for research purpose?

I am working in less established lab with lack of funding from india. I am doing Neurotransmitters estimation from rat brain homogenate. if anyone provide me 10-20mg of glutamate HPLC standard it...

01 February 2016 5,892 0 View

How do I choose the appropriate statistics test and post hoc analysis for animal behaviour analysis?

Hello to everyone!!! I am doing animal behaviour and biochemical analysis for my studies, i have four groups control and three different stress groups. For my study i...

10 November 2015 10,120 4 View

How to learn more about SPSS and its Application?

I would like to learn more about SPSS and Its application especially in regards to data analysis. Please suggest me how I can learn more about it. Thank you so much.

11 August 2024 9,101 4 View

Can I base on reverse DNA sequences to perform alignment, convert to amino acids and GenBank submission?

I have reverse sequences (AB1 format), can I base on reverse DNA sequences to perform nucleotide alignment, convert nucleotides to amino acids and deposit the sequence in GenBank database?

11 August 2024 5,138 1 View

Baseline drift in HPLC? What causes this?

Hello, Why do i see this baseline drift when i compare my blank (black) to the sample (blue)? Any suggestions as to why this happened? Thank you!

11 August 2024 3,770 4 View

Text-Communication from the M1 Hand Area using BCI—and then there is Elon Musk?

Willett, Shenoy et al. (2021) have developed a brain computer interface (BCI) that used neural signal collected from the hand area of the motor cortex (area M1) of a paralyzed patient. The...

10 August 2024 7,180 0 View

Has anyone applied Python in the field of textile engineering for data analysis, automation, or smart textiles?

I'm currently exploring the application of Python in textile engineering, specifically in areas like data analysis, process automation, and the development of smart textiles. I'm interested in...

10 August 2024 7,429 2 View

How can I use the cif data obtained from rietveld refinement extracted via gsas2, for microstructural analysis using ETEX software?

09 August 2024 7,718 0 View

Is there any cases algae not using the nutrient from the wastewater and grow normally?

I am working on microalgae cultivation using waste water. The initial concentration of nutrients were less but the microalgae has achieved biomass growth of 2 g/L. The final concentration of...

08 August 2024 4,812 2 View

How are iso-frequency contours plotted?

Let's say we have a standard, regular hexagonal honeycomb with a 3-arm primitive unit cell (something like the figure attached; the figure is only representative and not drawn to scale). The...

07 August 2024 1,937 1 View

Is changing the medium during the experiment overestimate the results?

I am experimenting with cancer and non-cancer cells in a 12-well plate for 4 days with a seeding density 1*10^4/well, however, I noticed that the control group growth rate slows down on D3. Should...

07 August 2024 2,283 2 View

How to prepare the nanoparticle treated fungal sample for Environmental SEM analysis?

A fungal strain was treated with nanoparticles. We want to do an environmental SEM analysis. So could anyone share your views on preparing the sample? Thank you.

07 August 2024 5,307 1 View