Is it possible to deliver nanoparticles intranasally to a rat?

Sakthivel Govindaraj @Sakthivel_Govindaraj2

06 June 2014 1 6K Report

Is it possible to deliver the nanoparticles size of 100-200nm intranasally into the brain to a rat? Is there any size range particular to intranasal drug administration?

Rakesh Kumar Tekade

Hi Shakthivel,

Yes it is possible to deliver such Nps to brain intranasaly. You can achieve so by coating with certain mucoadhesive polymers like Chitosan.

Please check chitosan coated nanoparticles for brain delivery 'keyword' on pubmed and you wil find many artyicles.

Wishes

Rakesh

Badges
Science topic

More Sakthivel Govindaraj's questions See All

How to fix the sample size for human questionnaire study? Is there any formula to fix the sample size in human study?

How to fix the sample size for human questionnaire study

06 July 2019 4,640 6 View

Does circadian rhythm change and sleep deprivation deferentially affects the brain? which is having more adverse effects?

Dear all, How circadian rhythm change and sleep deprivation affects the brain? does both acts deferentially or same way on the brain and what are the consequences? which has more negative...

11 December 2017 8,546 5 View

Does anyone have experienced the white band pattern in western blot technique for phosphorylated form of AKT protein expression?

Hello Dear Friends, I have experienced a problem in the pAKT protein expression, it shows white color band. I have used recently purchased santa cruz antibody, primary antibody...

02 March 2017 1,195 5 View

How to do Two-way ANOVA in SPSS for four groups and comparing between two different time points within the groups and between the groups?

Hello to everyone I am working in the field of stress physiology, I am comparing different parameters between Male animals Vs Female animals and within Male and female animals, each group contains...

09 October 2016 580 2 View

Is there anyone have experienced estimation of 11 beta hydroxysteriod dehydrogenase (11HSD1 b) from rat plasma samples?

Hello everyone!!! I have gone through a protocol for the estimation of 11 beta HSD1 from rat by ELIZA kit method, in that they mentioned that can use tissue homogenates and other...

08 September 2016 9,947 1 View

Why gene expression was not observed in real-time qPCR but it was observed in conventional PCR?

Dear all! I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence Forward primer AGAAGAGGACACAGATGGCTTTGT Reverse...

08 September 2016 4,018 5 View

How to select the appropriate statistical method for Questionnaire based survey study?

Hello to everybody!!! I have conducted a questionnaire-based survey study on how prenatal stress linked with offspring's autism spectrum disorder (ASD). I have two groups, I)...

05 June 2016 6,204 3 View

Why and what would be the reason for HPLC-ECD detector showing out of range?

I am working with HPLC with ECD detector for neurotransmitter estimation from rat brain homogenate.. Few days back when i was doing HPLC, the base line reached from 2.5mV to around 1000 mV...

01 February 2016 1,915 7 View

Can anyone provide me Glutamate neurotransmitter (HPLC standard) for research purpose?

I am working in less established lab with lack of funding from india. I am doing Neurotransmitters estimation from rat brain homogenate. if anyone provide me 10-20mg of glutamate HPLC standard it...

01 February 2016 5,892 0 View

How do I choose the appropriate statistics test and post hoc analysis for animal behaviour analysis?

Hello to everyone!!! I am doing animal behaviour and biochemical analysis for my studies, i have four groups control and three different stress groups. For my study i...

10 November 2015 10,120 4 View

Why do we equate male and female arousal?

Women, on the other hand, can become physically aroused (increased blood flow in the reproductive organs) without becoming psychologically aroused even in the slightest. (Robert Weiss)

05 August 2024 9,537 2 View

Nano Orange protein quant on the Quantus fluorometer?

Is anyone here using the Thermo Fisher Nano Orange kit for protein quantification, and detecting the fluorescent signal on the Promega Quantus? We are struggling to make sense of the standard...

05 August 2024 8,946 3 View

The Curse of Evolution and Complexity?

Brain and body mass together are positively correlated with lifespan (Hofman 1993). The duration of neural development is one of the best predictors of brain size, and conception is the best...

05 August 2024 6,247 3 View

For an in-vitro drug release study, what molecular weight cut-off (MWCO) dialysis bag is required for a 117 kDa protein?

kindly reply me. Thanking you in advance.

05 August 2024 7,727 4 View

ANY free software for reconstructing neurons in the microscopic image?

Hi everyone, I am working on brain slices for visualizing a protein in the soma and dendrites, using a fluorescence tag. However, I need a tool (not paid) for reconstruction of the whole neuron,...

04 August 2024 4,725 2 View

In what part of the brain´s rabbit bdnf is located and include references please?

I´ve been unable to find specific information about this neurotrophin in the CNS of rabbits exclusively. There is extensive info in mice, fish and rats, but in brain´s rabbit is hard to find....

04 August 2024 762 1 View

Do You Know Untreated TMJ Affects Your Brain And Entire Body?

04 August 2024 6,282 1 View

PBMC infection with virus?

In my study, I intend to infect PBMCs with SARS-CoV-2. After that, I will analyze NK cells by flow cytometry to see if their phenotype changes or if they show degranulation. After the infection, I...

01 August 2024 4,403 4 View

What is the best protocol for freezing the rat brain in preparation for protein detection by Elisa ?

What is the best way to freeze the rat brain - liquid nitrogen, Dry ice , isopentane - after isolation for later protein investigation by Elisa?

01 August 2024 1,722 1 View

How to Post-fix Mice pup's brains?

I need to Postfix mice brains. I slice the brains using microtome at 40 microns. These are Postnatal days 7, 11, 14, and 21. I am using half the brain for other analysis, so I need to fresh freeze...

31 July 2024 1,123 4 View