Dear all!
I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence
Forward primer AGAAGAGGACACAGATGGCTTTGT
Reverse primer ATGACATTTGCCTTTGGGCCTGAG this sequence consist of 24 bp length, the product length is 168bp and annealing is temperature 64C (annealing temperature fixed by gradient method). When i perform real time qPCR the expression was not observed whereas, when i performed the gradient PCR by conventional method the expression of gene was observed.
The following is the gel picture of shank2 gene in the gradient temperature from 60°C-65°C. The picture shows that from annealing temperature 61°C-630°C expression of shank2 gene was observed but also found lot of non-specific product but in 64°C temperature product of interest shank2 alone was expressed and contains product length of 168bp.
so, what would be the possible reason for amplifying in the conventional method but not in real time qPCR?
Thanks in advance for your valuable suggestion.
¿Are you using a fluorescent probe for qPCR detection? If that's the case it might not be working properly. If you are using a binding dye, ¿are you using the same protocol and products for PCR and qPCR?
Sakthi are the machine brand and reagent brands are the same ? Just curious because i have experienced once that AB kits doesn't suit with Roche machine. Probably that could be also the reason
Hi Sakthivel, your gel pic looks just fine, the amount of aspecific products are almost neglectable. If you use the same primer pair and similar cycling conditions in the qPCR experiment, you should get very similar amplification in the qPCR as in the gradient PCR. Therefore I agree with previous answers that point to a quite reasonable explanation, you may have a detection problem on the qPCR. Check your qPCR reactions on a gel, if you have the product, then there is an issue with the detection. The qPCR machine may not have been set up properly (wavelenghts, filters, sensitivity etc) or the chemistry was wrong.
Hello Marcos!!!
I am using SYBR green master mix for real time qPCR. The protocol has been followed for both conventional PCR and qPCR, 64C annealing temperature, and 72C extension.
Hello Murugadas!!!
Yes both PCR are from Bio-Rad company and reagent has been used are different for real-time PCR I have used SYBR green master mix from Takara..
Hello Balazs!!!
I have used same machine and reagents for many other gene expression that works good but shank2 gene alone is not working in the real time quantification method.
Do you realize that SYBR green master mix from Takara recommends to use only 5 sec at 95°C for denaturation during the next cycles after initial denaturiation of 30 sec? I'm not clear whether you use this or a longer time, the enzyme in the ExTaq II premix is very sensitive to temperature and could be easily damage by longer exposure to 95 °C.
- Badges
- Science topic