Dear all!

I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence

Forward primer AGAAGAGGACACAGATGGCTTTGT

Reverse primer ATGACATTTGCCTTTGGGCCTGAG this sequence consist of 24 bp length, the product length is 168bp  and annealing is temperature 64C (annealing temperature fixed by gradient method).  When i perform real time qPCR the expression was not observed whereas, when i performed the gradient PCR by conventional method the expression of gene was observed.

The following is the gel picture of shank2 gene in the gradient temperature from 60°C-65°C. The picture shows that from annealing temperature 61°C-630°C expression of shank2 gene was observed but also found lot of non-specific product but in 64°C temperature product of interest shank2 alone was expressed and contains product length of 168bp.  

so, what would be the possible reason for amplifying in the conventional method but not in real time qPCR?

Thanks in advance for your valuable suggestion.

More Sakthivel Govindaraj's questions See All
Similar questions and discussions