Is it possible to record the ERP in a rat?

More Sakthivel Govindaraj's questions See All

How to fix the sample size for human questionnaire study? Is there any formula to fix the sample size in human study?

How to fix the sample size for human questionnaire study

06 July 2019 4,640 6 View

Does circadian rhythm change and sleep deprivation deferentially affects the brain? which is having more adverse effects?

Dear all, How circadian rhythm change and sleep deprivation affects the brain? does both acts deferentially or same way on the brain and what are the consequences? which has more negative...

11 December 2017 8,546 5 View

Does anyone have experienced the white band pattern in western blot technique for phosphorylated form of AKT protein expression?

Hello Dear Friends, I have experienced a problem in the pAKT protein expression, it shows white color band. I have used recently purchased santa cruz antibody, primary antibody...

02 March 2017 1,195 5 View

How to do Two-way ANOVA in SPSS for four groups and comparing between two different time points within the groups and between the groups?

Hello to everyone I am working in the field of stress physiology, I am comparing different parameters between Male animals Vs Female animals and within Male and female animals, each group contains...

09 October 2016 580 2 View

Is there anyone have experienced estimation of 11 beta hydroxysteriod dehydrogenase (11HSD1 b) from rat plasma samples?

Hello everyone!!! I have gone through a protocol for the estimation of 11 beta HSD1 from rat by ELIZA kit method, in that they mentioned that can use tissue homogenates and other...

08 September 2016 9,947 1 View

Why gene expression was not observed in real-time qPCR but it was observed in conventional PCR?

Dear all! I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence Forward primer AGAAGAGGACACAGATGGCTTTGT Reverse...

08 September 2016 4,018 5 View

How to select the appropriate statistical method for Questionnaire based survey study?

Hello to everybody!!! I have conducted a questionnaire-based survey study on how prenatal stress linked with offspring's autism spectrum disorder (ASD). I have two groups, I)...

05 June 2016 6,204 3 View

Why and what would be the reason for HPLC-ECD detector showing out of range?

I am working with HPLC with ECD detector for neurotransmitter estimation from rat brain homogenate.. Few days back when i was doing HPLC, the base line reached from 2.5mV to around 1000 mV...

01 February 2016 1,915 7 View

Can anyone provide me Glutamate neurotransmitter (HPLC standard) for research purpose?

I am working in less established lab with lack of funding from india. I am doing Neurotransmitters estimation from rat brain homogenate. if anyone provide me 10-20mg of glutamate HPLC standard it...

01 February 2016 5,892 0 View

How do I choose the appropriate statistics test and post hoc analysis for animal behaviour analysis?

Hello to everyone!!! I am doing animal behaviour and biochemical analysis for my studies, i have four groups control and three different stress groups. For my study i...

10 November 2015 10,120 4 View

Can I multiplex a mouse monoclonal and rat primary for IHC (mouse brain tissue)?

Hi all, I was just wondering if anyone has experience with multiplexing a mouse monoclonal primary and a rat primary. I'm trying to multiplex by incubating them in the same well but was told by a...

06 August 2024 9,710 1 View

In what part of the brain´s rabbit bdnf is located and include references please?

I´ve been unable to find specific information about this neurotrophin in the CNS of rabbits exclusively. There is extensive info in mice, fish and rats, but in brain´s rabbit is hard to find....

04 August 2024 762 1 View

What can be the minimum number of animals (rats) to be used for a pilot/preliminary study on intradermal drug delivery?

Dear All I would like to know the minimum number of animals (rats) to be studied for a pilot/preliminary research on intradermal drug delivery. Can I proceed with 1 animal per group for a pilot work?

02 August 2024 4,570 1 View

What do you consider to be the most relevant elements of EEG for studying cognitive biases?

I've seen articles that primarily focus on alpha and beta activity in the frontal regions, but these studies often compare healthy subjects with those having various pathologies. I haven't seen a...

31 July 2024 7,259 1 View

How to perform EEG source analysis on each trial of data separately?

Hello Everyone I have a question about structure for connectivity analysis on sources. My goal: preprocess and cut data into trials create headmodels, using template MRI file perform source...

30 July 2024 2,744 1 View

CAD File of human's & rat's respiratory airways ?

Dear all, I am working on particle deposition in human's & rat's respiratory airways using CFD and I am looking for the 3D CAD file for my simulations (STEP or IGES format). If somone has such...

29 July 2024 1,092 2 View

How to use ERP System in Global University ?

27 July 2024 8,229 0 View

Why only alpha wave of brain are found in some patients?

I have found an EEG where only alpha waves are present. Beta waves are not found in active patients. What interpretations ?

26 July 2024 4,741 1 View

Could GSH level be more in CCL4 rats than negative control rats?

i compare between the antioxidant and oxidative stress level between negative control rats (saline) and CCL4 intoxicated rats. i found the level of GSH and TAC is more in toxic group than normal....

26 July 2024 1,887 0 View

Where do I download the codes, databases commonly used by researchers?EMG,EEG,etc?

Where do I download the codes, databases commonly used by researchers?

16 July 2024 295 0 View

Béatrice Marianne Ewalds-Kvist

Eur Rev Med Pharmacol Sci. 2014 Jul;18(13):1859-68.

A mechanism study on propofol's action on middle latency auditory evoked potential by neurons in ventral partition of medial geniculate body in rats.

Shi QQ, Sun X, Fang H.

Vladimir A. Kulchitsky

Please, find some papers below. I hope you will get an answer. Vladimir

Gijs Plomp

Certainly, see e.g. these studies for how to record large-scale epicranial EEG in anesthetized rodents:

http://www.jneurosci.org/content/31/26/9574.full

http://www.jneurosci.org/content/29/16/5326.long