Why will replication take place at the 5'-3' prime end?

Sakthivel Govindaraj @Sakthivel_Govindaraj2

07 July 2014 0 10K Report

What is the reason that replication will takes place 5'-3' prime end?

Badges
Science topic

More Sakthivel Govindaraj's questions See All

How to fix the sample size for human questionnaire study? Is there any formula to fix the sample size in human study?

How to fix the sample size for human questionnaire study

06 July 2019 4,640 6 View

Does circadian rhythm change and sleep deprivation deferentially affects the brain? which is having more adverse effects?

Dear all, How circadian rhythm change and sleep deprivation affects the brain? does both acts deferentially or same way on the brain and what are the consequences? which has more negative...

11 December 2017 8,546 5 View

Does anyone have experienced the white band pattern in western blot technique for phosphorylated form of AKT protein expression?

Hello Dear Friends, I have experienced a problem in the pAKT protein expression, it shows white color band. I have used recently purchased santa cruz antibody, primary antibody...

02 March 2017 1,195 5 View

How to do Two-way ANOVA in SPSS for four groups and comparing between two different time points within the groups and between the groups?

Hello to everyone I am working in the field of stress physiology, I am comparing different parameters between Male animals Vs Female animals and within Male and female animals, each group contains...

09 October 2016 580 2 View

Is there anyone have experienced estimation of 11 beta hydroxysteriod dehydrogenase (11HSD1 b) from rat plasma samples?

Hello everyone!!! I have gone through a protocol for the estimation of 11 beta HSD1 from rat by ELIZA kit method, in that they mentioned that can use tissue homogenates and other...

08 September 2016 9,947 1 View

Why gene expression was not observed in real-time qPCR but it was observed in conventional PCR?

Dear all! I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence Forward primer AGAAGAGGACACAGATGGCTTTGT Reverse...

08 September 2016 4,018 5 View

How to select the appropriate statistical method for Questionnaire based survey study?

Hello to everybody!!! I have conducted a questionnaire-based survey study on how prenatal stress linked with offspring's autism spectrum disorder (ASD). I have two groups, I)...

05 June 2016 6,204 3 View

Why and what would be the reason for HPLC-ECD detector showing out of range?

I am working with HPLC with ECD detector for neurotransmitter estimation from rat brain homogenate.. Few days back when i was doing HPLC, the base line reached from 2.5mV to around 1000 mV...

01 February 2016 1,915 7 View

Can anyone provide me Glutamate neurotransmitter (HPLC standard) for research purpose?

I am working in less established lab with lack of funding from india. I am doing Neurotransmitters estimation from rat brain homogenate. if anyone provide me 10-20mg of glutamate HPLC standard it...

01 February 2016 5,892 0 View

How do I choose the appropriate statistics test and post hoc analysis for animal behaviour analysis?

Hello to everyone!!! I am doing animal behaviour and biochemical analysis for my studies, i have four groups control and three different stress groups. For my study i...

10 November 2015 10,120 4 View

What is the reason for current dropping in OER , LSV curve?

I tried four trials of the same Copper Phosphides sample in Alkaline medium ( 0.5M KOH) with Hg/HgO reference electrode and Pt as counter electrode. I used 0.001 V/s scan rate for first three...

10 August 2024 3,629 1 View

What may be the reasons for failures of Tube toi Tube Sheet Joints in Boiler Drum ?

We have observed that tube to tube sheet joint leaked in our boiler and needs to overcome same by knowing the root cause.

08 August 2024 3,161 0 View

How can I apply boundary conditions in an orthotropic steel deck numerical model using ABAQUS software?

I am trying to simulate vehicular loading on an orthotopic steel deck bridge section in ABAQUS software. The red arrow mark in the attached figure indicates the direction in which the vehicle will...

08 August 2024 719 0 View

Unusual intensity drop in some sections of chromatograms in DDA?

Hi, we have measured tryptic peptides using both DDA and DIA method on QExactive. In DDA replicates i saw unusual intensity drops occurring at the same sections of chromatograms in DDA replicates...

07 August 2024 3,218 4 View

How to normalize and take the significance of the MTT OD values with 3 replicates for the same cell-line?

Hi, I have a question about normalizing the MTT OD values for doing the statistical analysis. So, if we have 3 different plates and we call them 3 different replicates, so, first we would...

07 August 2024 8,106 4 View

What is the problem with these tissue culture plants?

All plants are green but some of these plants becomes yellow. I did not found any reason. Please help me to find out the real problem.

01 August 2024 589 4 View

How can I select cells in prime editing without fluorescence-activated cell separation?

31 July 2024 8,551 2 View

Reason for discontinuities in my Band structure?

Hey All! I am wondering what might be wrong with my band structure. I did the calculations using VASP and plotted the results using Origin. Although I have tried changing various input...

25 July 2024 2,920 11 View

Is it fare for editors of reputed Journals to put on hold manuscripts more than six months without review updates, Are they harassing researchers?

It is being seen that Editors of some reputed Journals are putting on hold the manuscripts and not updating review states even passing more than six months from submission. Researchers are...

24 July 2024 8,596 2 View

Does anyone know a source for theta-replicating Staphylococcus plasmids that are compatible?

I am trying to put 3 separate plasmids into Staphylococcus aureus and I am looking for those that are theta replicating and compatible. I have obtained pSK9065 (from pSK1) from Addgene, but the...

23 July 2024 6,968 0 View