What is the difference between short communication, research article and letters?

Sakthivel Govindaraj @Sakthivel_Govindaraj2

12 December 2014 0 3K Report

What kind of work can be published in short communication and letters? how it differs from research article?

Badges
Science topic

More Sakthivel Govindaraj's questions See All

How to fix the sample size for human questionnaire study? Is there any formula to fix the sample size in human study?

How to fix the sample size for human questionnaire study

06 July 2019 4,640 6 View

Does circadian rhythm change and sleep deprivation deferentially affects the brain? which is having more adverse effects?

Dear all, How circadian rhythm change and sleep deprivation affects the brain? does both acts deferentially or same way on the brain and what are the consequences? which has more negative...

11 December 2017 8,546 5 View

Does anyone have experienced the white band pattern in western blot technique for phosphorylated form of AKT protein expression?

Hello Dear Friends, I have experienced a problem in the pAKT protein expression, it shows white color band. I have used recently purchased santa cruz antibody, primary antibody...

02 March 2017 1,195 5 View

How to do Two-way ANOVA in SPSS for four groups and comparing between two different time points within the groups and between the groups?

Hello to everyone I am working in the field of stress physiology, I am comparing different parameters between Male animals Vs Female animals and within Male and female animals, each group contains...

09 October 2016 580 2 View

Is there anyone have experienced estimation of 11 beta hydroxysteriod dehydrogenase (11HSD1 b) from rat plasma samples?

Hello everyone!!! I have gone through a protocol for the estimation of 11 beta HSD1 from rat by ELIZA kit method, in that they mentioned that can use tissue homogenates and other...

08 September 2016 9,947 1 View

Why gene expression was not observed in real-time qPCR but it was observed in conventional PCR?

Dear all! I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence Forward primer AGAAGAGGACACAGATGGCTTTGT Reverse...

08 September 2016 4,018 5 View

How to select the appropriate statistical method for Questionnaire based survey study?

Hello to everybody!!! I have conducted a questionnaire-based survey study on how prenatal stress linked with offspring's autism spectrum disorder (ASD). I have two groups, I)...

05 June 2016 6,204 3 View

Why and what would be the reason for HPLC-ECD detector showing out of range?

I am working with HPLC with ECD detector for neurotransmitter estimation from rat brain homogenate.. Few days back when i was doing HPLC, the base line reached from 2.5mV to around 1000 mV...

01 February 2016 1,915 7 View

Can anyone provide me Glutamate neurotransmitter (HPLC standard) for research purpose?

I am working in less established lab with lack of funding from india. I am doing Neurotransmitters estimation from rat brain homogenate. if anyone provide me 10-20mg of glutamate HPLC standard it...

01 February 2016 5,892 0 View

How do I choose the appropriate statistics test and post hoc analysis for animal behaviour analysis?

Hello to everyone!!! I am doing animal behaviour and biochemical analysis for my studies, i have four groups control and three different stress groups. For my study i...

10 November 2015 10,120 4 View

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

May members post flyers about opportunities to present at a conference? If so, where to post?

May members post flyers about opportunities to present at a conferehttps://veraeducation.com/nce? If so, where to post for the Virginia Educational Research Association? https://veraeducation.com/

08 August 2024 4,585 1 View

Hello all, Looking for international reviewer to review Ph.D thesis in wireless sensor network.Can anybody help?

My name is Apurva Saoji. I am a Ph.D scholar in Computer engineering in India. I am looking for international expert in reviewing my PhD thesis, "Competitive Optimization Techniques to Minimize...

07 August 2024 4,600 2 View

Is there anyone with experience in TEM analysis who can assist with a manuscript for an upcoming journal?

Hello dear colleagues, We have prepared a manuscript on NiTi-based alloys and are seeking a second opinion on our current TEM results. If you are a Ph.D. holder with experience in TEM and have...

07 August 2024 9,563 0 View

Hello Everyone ! I'm looking for a good journal to publish my manuscript with low publication cost?

I am Looking for a Science Journal with good impact factor and low publication cost to publish a review paper. Your suggestions would be appreciated.

06 August 2024 6,796 3 View

Is an invitation to join the editorial board of Clinical Cardiology Updates a scam?

I received an e-mail invitation to join the editorial board of Clinical Cardiology Updates. While I have published a few articles related to cardiovascular disease, there are lots of colleagues...

06 August 2024 8,981 8 View

Research Methodology - Impact of Corporate Reputation on Stakeholders Behaviors?

Please can anyone support with the survey questions based on RQ measures and propose how to do it in FMCG industry and include as well the role of brand equity Thanks

06 August 2024 949 0 View

Why is the Protocol for Preventing Postpartum Hemorrhage (https://pubmed.ncbi.nlm.nih.gov/36113283/ ) not being widely adopted?

If the placenta is delivered in squatting position within 3 minutes of the birth of the baby, postpartum hemorrhage is completely eliminated. It works every time. It is quite likely that if a...

05 August 2024 8,895 0 View

How to report results of Generalised Linear Mixed Models in a journal article?

Hi everyone, If you have written or come across any papers where Generalised Linear Mixed Models are used to examine intervention (e.g., in mental health) efficacy, could you please share the...

04 August 2024 4,130 4 View

Why results of ROS flurescence are negative as there was no bacteria within?

Hello. I am working on ROS production of two systems: system A is cerium oxide and hydrogen peroxide, system B is cerium oxide nanoparticle, hydrogen peroxide and potassium bromide. I did some...

04 August 2024 5,974 3 View