Is there any relationship between visual perception and anxiety/stress?

Sakthivel Govindaraj @Sakthivel_Govindaraj2

08 August 2014 1 4K Report

Is there any relationship between visual perception and anxiety/stress? some times while seeing some things or crowd of people or in the stage in front of audience we feel stressed or nervous and anxiety.

Damian G Kelty-Stephen

Perhaps you'd be interested in the research here:

https://www.researchgate.net/publication/51582010_Positive_emotions_broaden_the_scope_of_attention_and_thought-action_repertoires

Article Positive Emotions Broaden the Scope of Attention and Thought...

Badges
Science topic

More Sakthivel Govindaraj's questions See All

How to fix the sample size for human questionnaire study? Is there any formula to fix the sample size in human study?

How to fix the sample size for human questionnaire study

06 July 2019 4,640 6 View

Does circadian rhythm change and sleep deprivation deferentially affects the brain? which is having more adverse effects?

Dear all, How circadian rhythm change and sleep deprivation affects the brain? does both acts deferentially or same way on the brain and what are the consequences? which has more negative...

11 December 2017 8,546 5 View

Does anyone have experienced the white band pattern in western blot technique for phosphorylated form of AKT protein expression?

Hello Dear Friends, I have experienced a problem in the pAKT protein expression, it shows white color band. I have used recently purchased santa cruz antibody, primary antibody...

02 March 2017 1,195 5 View

How to do Two-way ANOVA in SPSS for four groups and comparing between two different time points within the groups and between the groups?

Hello to everyone I am working in the field of stress physiology, I am comparing different parameters between Male animals Vs Female animals and within Male and female animals, each group contains...

09 October 2016 580 2 View

Is there anyone have experienced estimation of 11 beta hydroxysteriod dehydrogenase (11HSD1 b) from rat plasma samples?

Hello everyone!!! I have gone through a protocol for the estimation of 11 beta HSD1 from rat by ELIZA kit method, in that they mentioned that can use tissue homogenates and other...

08 September 2016 9,947 1 View

Why gene expression was not observed in real-time qPCR but it was observed in conventional PCR?

Dear all! I have found problem in gene expression of shank2 gene in rat brain homogenate by qPCR method. The following are the primer sequence Forward primer AGAAGAGGACACAGATGGCTTTGT Reverse...

08 September 2016 4,018 5 View

How to select the appropriate statistical method for Questionnaire based survey study?

Hello to everybody!!! I have conducted a questionnaire-based survey study on how prenatal stress linked with offspring's autism spectrum disorder (ASD). I have two groups, I)...

05 June 2016 6,204 3 View

Why and what would be the reason for HPLC-ECD detector showing out of range?

I am working with HPLC with ECD detector for neurotransmitter estimation from rat brain homogenate.. Few days back when i was doing HPLC, the base line reached from 2.5mV to around 1000 mV...

01 February 2016 1,915 7 View

Can anyone provide me Glutamate neurotransmitter (HPLC standard) for research purpose?

I am working in less established lab with lack of funding from india. I am doing Neurotransmitters estimation from rat brain homogenate. if anyone provide me 10-20mg of glutamate HPLC standard it...

01 February 2016 5,892 0 View

How do I choose the appropriate statistics test and post hoc analysis for animal behaviour analysis?

Hello to everyone!!! I am doing animal behaviour and biochemical analysis for my studies, i have four groups control and three different stress groups. For my study i...

10 November 2015 10,120 4 View

Is it possible to plot the atom-projected band structure using GPAW?

Hi, I'm currently working on a project where I need to plot the atom-projected band structure using GPAW. I've been able to calculate the band structure for my material, but I'm having trouble...

07 August 2024 269 3 View

Why does everyone use vs code?

Visual Studio Code (VS Code) has become a popular choice among developers for several reasons: 1. **Free and Open Source**: VS Code is free to use and open source, making it accessible to...

07 August 2024 7,013 4 View

What condition of Kirat Rai's participation in politics before and now in Nepal?

The political participation of the Kirat Rai community in Nepal has evolved significantly over time: Historical Context Historically, the Kirat Rai people, like many indigenous groups in Nepal,...

05 August 2024 5,950 1 View

What is the role of oxidative stress in toxin-induced carcinogenesis?

What is the role of oxidative stress in toxin-induced carcinogenesis? I am currently researching the impact of environmental toxins on children's health and would greatly appreciate insights from...

02 August 2024 3,174 1 View

What should I do in this situation ?

I'm an undergraduate university student conducting research on the effects of internet use on depression and anxiety among undergraduate Ghanaian university students: Mediation role of Internet...

31 July 2024 2,979 3 View

Could GSH level be more in CCL4 rats than negative control rats?

i compare between the antioxidant and oxidative stress level between negative control rats (saline) and CCL4 intoxicated rats. i found the level of GSH and TAC is more in toxic group than normal....

26 July 2024 1,887 0 View

Can we eliminate the stress singularity at the tip of the crack by manipulating the elastic constants?

The aim of the research here is to prevent the propagation of the crack in the fabricated elastic medium with useful applications.

25 July 2024 9,976 3 View

Can you visualize platelets using EVOS ?

Hi all, My lab has Thermo Scientific™ Invitrogen™ EVOS™ FL Auto 2 Imaging System, and I was wondering if I will be able to use it with whole blood, whilst focusing on platelets? The idea would...

24 July 2024 9,337 3 View

How do nutrient transporters and aquaporins interact under abiotic stress in plants?

"The Correlation between Nutrition and Transport Mechanism under Abiotic Stress in Plants: A Comprehensive Review" by Muhammad Saleem, Jianhua Zhang, Muhammad Qasim, Rashid Iqbal, and Li Song,...

23 July 2024 9,109 0 View

How can I determine if a drug binds to a ribosome using a Cryo-EM map?

Hello, I am searching for the binding position of a drug in a ribosome, based on previous work indicating it binds there. The resolution of the ribosome-drug Cryo-EM map is around 2.5 Å. I've been...

19 July 2024 2,155 0 View