Contact experts in Tissue to get answers
1,318 views 4,465 posts
Questions related to Tissue
Recently I have recurring issue with MEGA X when I genblast a seq from an alignment .mas file. I receive a SUBMITTED URI TOO LARGE The length of the requested URL exceeds the capacity for this...
19 April 2024 6,150 0 View
Hi everyone, I'm seeking advice on the best gating strategy for analyzing Hoechst 33342 vs. Pyronin Y fluorescence in my flow cytometry data. I'm particularly interested in identifying a quiescent...
18 April 2024 3,150 0 View
Hi I need help in finding a good book describing functionalized nanoclays and their biomedical applications. I have been looking for it over google scholar but unable to find the research, review...
17 April 2024 5,971 1 View
We have a demarcation and analysis protocol in ImageJ for images of C. elegans stained with Oil Red O. However, it does not seem to be the best way and we were unable to find an easy-to-execute...
16 April 2024 2,002 1 View
For purification of carbohydrases (carbohydrate degrading enzymes) from bacterial cell free supernatant (CFS), which Ion exchange resin can be used? Are there prepacked columns available for the...
15 April 2024 3,679 0 View
Why is the Coot real space refine zone indicator green even in regions where the model has no density support? Doesn't this indicator combine both stereochemistry and density parameters?
15 April 2024 2,799 1 View
This is High Tc (Bi,Pb)SCCO Superconductor and in XPS spectra , we have got three peaks for Sr 3d but generally, as we know there are two peaks for Sr (3d 5/2 and 3d 3/2). what would be the...
14 April 2024 1,212 5 View
In my current research, I am investigating the characterization of bacteria capable of degrading crude oil. The quantify the crude oil degrading ability of the bacteria, the existing protocol...
12 April 2024 6,668 3 View
Discuss the use of multimodal analgesia techniques, including oral analgesics, regional techniques, and non-pharmacological interventions, for postpartum pain management. Multimodal analgesia...
10 April 2024 1,526 1 View
Uterine rupture is a rare but serious obstetric complication characterized by the tearing of the uterine wall, often leading to life-threatening hemorrhage and fetal distress. The anaesthetic...
10 April 2024 4,207 1 View
Outline the anaesthetic management of obstetric complication, placenta previa? Placenta previa is a condition where the placenta partially or completely covers the cervix, which can lead to severe...
10 April 2024 6,023 2 View
Oguzhan Zengi's study on the switch from gel-separator serum tubes to gel-separator lithium heparinized plasma (LIH) tubes in clinical chemistry was critically analyzed, leading to the formulation...
10 April 2024 9,055 1 View
A Vacancy of Sr Scientist Duration: 12 months Location: Bethesda, MD/USA Job Description: Contribute to the generation of stable cell lines for vaccine and therapeutic protein candidates...
10 April 2024 7,698 2 View
I wonder if anybody knows where I could find and download some sector scan ultrasound images? I need them for doing my homework.
08 April 2024 1,746 1 View
I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...
07 April 2024 3,931 4 View
Assisted suicide as become more common. Little is known about the lived experience and about grieving and coping processes of family members after assisted suicide. What helps family members cope...
05 April 2024 9,939 13 View
Good morning Research Gate scientists I have an LB agar plate for DH5a bacteria cell storage at 4C for 6 weeks, and I tried to subculture to a new plate plenty of times but I could not get...
04 April 2024 8,312 3 View
I am conducting research on the Salicornia plant, intending to evaluate and characterize it based on its root system. I have employed conventional methods such as measuring root length and...
03 April 2024 5,055 0 View
Hi all, We performed Yeast-Cell-Glucose-Uptake assay to estimate the antidiabetic potential of the test compound. The Metformin treated yeast cells, resulted in taking up more glucse than normal...
03 April 2024 7,614 2 View
Does dissolving the scaffolds in acid work to quantify that using spectrophotometer? or should i wait till the whole of the curcumin is released in the suspension media (PBS or curcumin solvent-...
02 April 2024 500 2 View
Can we extract water soluble P without using ion exchange resin strips during phosphorus fractionation analysis?
02 April 2024 8,824 0 View
The cross-match test is an in vitro test to determine the presence of anti-lymphocyte antibody to donor cell antigens (lymphocytotoxic antibody) in serum of an individual with preformed...
02 April 2024 3,168 1 View
In the BCA assay, are there any differences between the reported protein concentration directly from the cell suspension and from the protein extracted solution of the cells by RIPA buffer?
31 March 2024 8,343 0 View
Hi, is it possible to remove attached ligand from the PDB protein file and save it, to open for docking in Autodock?
29 March 2024 9,139 3 View