When I studied miRNA expression in normal tissues/cells the control that I used was U6 snRNA. Does someone know if this could be used also with breast cancer cells to estimate miRNA expression in those cells?
Yes you can use it, this is the best control that you can use, i used it during my Ph.D, following are the sequence that I used:
RNU6: GTGCTCGCTTCGGCAGCACATAT
U6 snRNA is definitely an option as a control. If you're searching for a miRNA as a control in your assay (some assays require a miRNA as a reference) I found that, (though in Glioblastoma cells) hsa-miR-423-5p could serve as an endogenous control that is expressed at rather similar levels throughout several glioma lines, and was not regulated under the conditions i used in the experiment. For their Advanced miRNA Assay (TaqMan based), Thermo recommends to test the following miRs as endogenous controls, stating that these are expressed relatively constant with moderately abundant across tissues and cell types and treatment protocols: hsa-miR-361-5p hsa-miR-186-5p, hsa-miR-26a-5p, hsa-miR-191-5p, hsa-miR-451, hsa-miR-423-5p, hsa-miR-320a.
Thank you Zainab Nizar Jawad , Hridesh Mishra and Sascha Seidel .
Best regards
Pedro
- Badges
- Science topic
- Similar topics
- Biological Science
- Biochemistry
- Biomolecules
- Nucleic Acids
- RNA
- Small RNA
- microRNA