Contact experts in DNA Extraction to get answers
2,329 views 1,692 posts
Questions related to DNA Extraction
merits and demerits should be mention.
01 February 2023 9,475 4 View
I tried several times, still self ligation and colonies with no shRNA insert.
26 January 2023 9,477 7 View
I have read that dd-PCR does not require a housekeeping gene - could anyone explain why? We are trying to design a dd-pcr triplex for avian immune gene expression. Thank you Ellie
19 January 2023 5,526 3 View
I am developing an analysis in factorial arrangement, and the interaction of the factors gives a total of 32 treatments. In the mean comparison analysis, it shows me differences at all levels,...
10 January 2023 10,092 4 View
I need to precipitate lots of RNA from a 10 mM MES pH 6 solution. I'm wondering if its essential to add Tris to adjust the pH to 8 for successful LiCl precipitation? Thanks!
10 January 2023 8,611 2 View
Hi previously, I used to use the online cap3 site to assemble the forward and reverse reads from Sanger sequencing. But unfortunately, this site currently has encountered a problem and I can't use...
29 December 2022 828 4 View
I've been unsuccessful to run ParallelStructure, both in RStudio and directly in R, even when I use the example data and joblist provided by the developers. I'm using Windows OS, so according to...
28 December 2022 7,146 0 View
I want to use the primer Fw_ITS1 (5'- AGGAGAAGTCGTAACAAGGT -3') to amplify algae but I don't seem to find the original paper of this primer. I can find it in most articles referred to White et...
27 December 2022 9,773 2 View
I am working with this kit and according to recommendation of Qiagen, this Investigator kit allows to extract 50 DNA samples as maximum. However, it can goes up to about 100 samples by mixing the...
26 December 2022 1,371 0 View
What type of adsorption mechanism is used for organic compound removal and biochar for removal of organic and inorganic pollutants from industrial wastewater?
24 December 2022 2,737 2 View
Hi guys, I am working on Akk culture and find that Akk cannot be well mixed even after vortexing and pipetting. Moreover, what counting method do you suggest? Akk cannot be well observed using...
16 November 2022 4,888 0 View
I'm a grad student working on metagenomics and I ran into some issues with the samples. I collected urine samples and extracted DNA using DNeasy Blood & Tissue kit. I used NanoDrop to measure...
14 November 2022 3,175 5 View
I have extracted the protein sample using Tris phenol method, and after extraction I have resuspended the sample in Tris Hcl...The extracted protein sample have a concentration of 10ug/ml through...
09 November 2022 8,555 2 View
Dear Genetic and Molecular gurus, I am after advice on best commercially available DNA extraction kits for the isolation of vertebrate DNA from serum samples? If you are aware of any formal,...
01 November 2022 3,322 0 View
How is the specimen preparation of TPU semicrystalline polymer 2mm sheet to observe morphology via Optical Microscopy and via SEM? I have 2 mm sheet of TPU (thermoplastic polyurethane) and gonna...
12 August 2022 2,087 0 View
looking for great method in order to reach that purpose
21 June 2022 10,032 0 View
Hi Community, Recently I have submitted samples for amplicon and found an unusually high number of reads being present in my negative control blank samples. Yet, when I ordinated those samples in...
20 May 2022 2,352 0 View
Hello, I have some SAED patterns taken from ZrN/Cu coatings deposited by reactive magnetron sputtering. When there is a preferred orientation in the microstructure, the corresponding ring is not...
03 May 2022 379 3 View
Hello, I need your help. I am working on a SARS-Cov2 seroprevalence study. I will isolate the plasmas using a ficoll gradient; I would also like to keep the PBMCs for future studies. I want to...
11 February 2022 4,394 3 View
I plan to use BALB/c mice for studying pneumonia caused by the mouse-adapted influenza virus (A/PR8/H1N1). I want to know, what is the requirement to determine the sex of an animal? It seems...
24 November 2021 3,462 4 View
Hello everyone. I hope this question doesn't make me look bad, but I'm hoping I'm just having a brain fog moment. I gave my cells that are seeded on transwells urea in both apical and...
17 November 2021 4,985 3 View
Hello everyone, we are trying to isolate DNA from fecal samples without using any kit. Any help regarding the protocol would be much appreciated. Thanks in advance.
12 November 2021 5,100 4 View
We are trying to cultivate some cyanobionts at our laboratory and found one Nostochopsis, but are not sure it is the symbiont or an external organism.
26 October 2021 4,269 0 View
Hello, I diluted stock solution of both MTX and doxo in RPMI today (separately) and was hoping to use the rest of the dilution tomorrow for some Jurkat cells (less than 24 hours after dilution),...
11 October 2021 6,173 2 View