Contact experts in DNA Extraction to get answers
1,107 views 1,658 posts
Questions related to DNA Extraction
I want to use the primer Fw_ITS1 (5'- AGGAGAAGTCGTAACAAGGT -3') to amplify algae but I don't seem to find the original paper of this primer. I can find it in most articles referred to White et...
27 December 2022 9,693 2 View
I am working with this kit and according to recommendation of Qiagen, this Investigator kit allows to extract 50 DNA samples as maximum. However, it can goes up to about 100 samples by mixing the...
26 December 2022 1,311 0 View
What type of adsorption mechanism is used for organic compound removal and biochar for removal of organic and inorganic pollutants from industrial wastewater?
24 December 2022 2,619 2 View
Hi guys, I am working on Akk culture and find that Akk cannot be well mixed even after vortexing and pipetting. Moreover, what counting method do you suggest? Akk cannot be well observed using...
16 November 2022 4,822 0 View
I'm a grad student working on metagenomics and I ran into some issues with the samples. I collected urine samples and extracted DNA using DNeasy Blood & Tissue kit. I used NanoDrop to measure...
14 November 2022 3,110 5 View
I have extracted the protein sample using Tris phenol method, and after extraction I have resuspended the sample in Tris Hcl...The extracted protein sample have a concentration of 10ug/ml through...
09 November 2022 8,471 2 View
Dear Genetic and Molecular gurus, I am after advice on best commercially available DNA extraction kits for the isolation of vertebrate DNA from serum samples? If you are aware of any formal,...
01 November 2022 3,207 0 View
How is the specimen preparation of TPU semicrystalline polymer 2mm sheet to observe morphology via Optical Microscopy and via SEM? I have 2 mm sheet of TPU (thermoplastic polyurethane) and gonna...
12 August 2022 2,018 0 View
looking for great method in order to reach that purpose
21 June 2022 9,963 0 View
Hi Community, Recently I have submitted samples for amplicon and found an unusually high number of reads being present in my negative control blank samples. Yet, when I ordinated those samples in...
20 May 2022 2,271 0 View
Hello, I have some SAED patterns taken from ZrN/Cu coatings deposited by reactive magnetron sputtering. When there is a preferred orientation in the microstructure, the corresponding ring is not...
03 May 2022 269 3 View
Hello, I need your help. I am working on a SARS-Cov2 seroprevalence study. I will isolate the plasmas using a ficoll gradient; I would also like to keep the PBMCs for future studies. I want to...
11 February 2022 4,271 3 View
I plan to use BALB/c mice for studying pneumonia caused by the mouse-adapted influenza virus (A/PR8/H1N1). I want to know, what is the requirement to determine the sex of an animal? It seems...
24 November 2021 3,362 4 View
Hello everyone. I hope this question doesn't make me look bad, but I'm hoping I'm just having a brain fog moment. I gave my cells that are seeded on transwells urea in both apical and...
17 November 2021 4,857 3 View
We are trying to cultivate some cyanobionts at our laboratory and found one Nostochopsis, but are not sure it is the symbiont or an external organism.
26 October 2021 4,212 0 View
Hello, I diluted stock solution of both MTX and doxo in RPMI today (separately) and was hoping to use the rest of the dilution tomorrow for some Jurkat cells (less than 24 hours after dilution),...
11 October 2021 6,080 2 View
I noticed on the Internet and even on RG that many researchers escape the answer of this question, where they say it is not good or bad, but it is low and high. For low SDs, we know that the...
30 September 2021 2,569 7 View
How to prepare the input file for software PERMUT to calculate Gst and Nst. I have 14 haplotypes from 15 populations (6-8 individuals in each population) and i need to know the presence of...
15 September 2021 3,890 0 View
Hello. I'm doing the experiment about detect of MICA/B and ULBP families on cancer cell. The antibodies that i used is MICA/B(e-bioscience 320918, PE-Cy7) and ULBP2/5/6(rndsystems FAB1298P,...
22 July 2021 798 1 View
Hello, I am struggling with library preparation for Illumina sequencing. Currently I prepared 6 libraries, but only 2 of them were OK and ready for sequencing. The other 4 contained high amount...
09 July 2021 9,624 0 View
Hi everyone, My cols and I got the QIAamp Fast DNA Stool Mini Kit in order to get DNA from sea lion scats to analyze the diet of these animals. However, a colleague warned not using this "Fast"...
17 June 2021 6,312 0 View
Hello, I've been having an issue with my PCR amplicon appearing smaller on a gel than it should be. For reference, the band should be ~500bp, but it consistently runs closer to 250 bp according to...
13 June 2021 8,596 6 View
I am collect population differentiation from published papers. Sometimes, there are no statistics such as Gst, Nst, Ht, Hs and their SE. I will calculate Gst and Nst using PERMUT...
13 June 2021 3,861 0 View
I have a concatenated file (fasta, nexus, or phylip) of ~550 loci. I need to convert this to a GENEPOP file format with different populations noted within it. Is there an easy way to accomplish...
27 May 2021 1,764 0 View