I want to use the primer Fw_ITS1 (5'- AGGAGAAGTCGTAACAAGGT -3') to amplify algae but I don't seem to find the original paper of this primer. I can find it in most articles referred to White et al., 1990 (Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics), but I can't find it in this paper. Does anyone have an idea what is the "real"/original paper that developed this primer?
Many thanks in advance.
Unfortunately I don't have it
If you get it, I will send it to you
Greetings
Thank you Abdellatif Rahmani
I found the original paper. It is the primer of White et al. (1990) modified by Hall et al. (2010).
Hall, J. D., Fučíková, K., Lo, C., Lewis, L. A., & Karol, K. G. (2010). An assessment of proposed DNA barcodes in freshwater green algae. Cryptogamie Algologie, 31(4), 529.
Hope it helps.
Najoua
- Badges
- Science method