Contact experts in DNA Extraction to get answers
851 views 1,521 posts
Questions related to DNA Extraction
I'm going to measure chlorophyll spectrophotometrically. Does anyone have a tried-and-tested, detailed protocol?
15 July 2023 4,848 4 View
I prepared the blood agar plate and stored it for two weeks and then taken out and did the streaking of different unknown bacteria onto the plate. After 24 hours, the entire Petri plate change...
06 July 2023 6,059 2 View
The growth of SF21 cells we are currently cultivating in SFM medium is not ideal. Is there any way to improve it?
01 July 2023 6,415 1 View
Hi all, here in Chile we are facing a brutal shortage of consumables of Merck-Sigma-Millipore, specially after the fusion of Merck with Sigma and the pandemia, anyway the thing is that ultra...
29 June 2023 3,104 1 View
I am amplifying a PCR fragment from virus. after I ran the sample in agarose gel, the marker looks just fine but the samples ran curved. can anyone explain. Thanks
21 June 2023 3,171 2 View
Hi every one, I our Skin Lab research, we focus in Pemphigus Vulgaris diseases, specific the association of ST18 gene with PV. We read the article "Etesami, Ifa, et al. "The association...
06 June 2023 1,249 2 View
Along with reference please
29 May 2023 7,160 2 View
I want to know the stationary phase PGPR pseudomonas such as fluorescence pseudomonas. can anyone help me what is the OD of those bacteria in stationary phase?
05 May 2023 9,498 3 View
Hi, deal all. We are trying to detect a secreted protein, about 20-35kDa, in the cell culture. What we used was the Amicom ultra-10kDa. We rinsed the filter with ddH20, centrifuged cuture...
28 April 2023 6,326 6 View
Hello, I used to work with MEGA 11 to build the phylogenetic trees etc. And to this end I got Huawei MateBook D 16 16" i7-12700H - 16GB RAM - 512GB with Win11. And I have a problems with runnig...
31 March 2023 8,015 1 View
The holothurian (sea cucumber) genus Thyone appears to be a "supergenus" with about 66 species worldwide and is in need of urgent revision. Apparently the taxonomy and phylogeny of this group is...
02 March 2023 513 2 View
Was just wondering what the recommended amount of time for cells to stay in HBSS is. Also what happens to the cells if they stay in this solution for prolonged amounts of time.
01 March 2023 8,012 1 View
I need to confirm that the antibacterial activity of the lactic acid bacterial strains is by bacteriocins(the antibacterial peptides). Are there any biochemical tests to confirm it?
15 February 2023 4,827 3 View
what are the factors that can contribute to the difference in efficacy between DNA and RNA encapsulation using microfluidic techniques?
09 February 2023 2,179 0 View
Relation between high yield plants fertilizer
05 February 2023 498 3 View
Either for a single gene or a list of genes
03 February 2023 3,210 0 View
merits and demerits should be mention.
01 February 2023 9,332 4 View
I tried several times, still self ligation and colonies with no shRNA insert.
26 January 2023 9,346 7 View
I have read that dd-PCR does not require a housekeeping gene - could anyone explain why? We are trying to design a dd-pcr triplex for avian immune gene expression. Thank you Ellie
19 January 2023 5,424 3 View
I am developing an analysis in factorial arrangement, and the interaction of the factors gives a total of 32 treatments. In the mean comparison analysis, it shows me differences at all levels,...
10 January 2023 9,961 4 View
I need to precipitate lots of RNA from a 10 mM MES pH 6 solution. I'm wondering if its essential to add Tris to adjust the pH to 8 for successful LiCl precipitation? Thanks!
10 January 2023 8,502 2 View
Hi previously, I used to use the online cap3 site to assemble the forward and reverse reads from Sanger sequencing. But unfortunately, this site currently has encountered a problem and I can't use...
29 December 2022 726 4 View
I've been unsuccessful to run ParallelStructure, both in RStudio and directly in R, even when I use the example data and joblist provided by the developers. I'm using Windows OS, so according to...
28 December 2022 7,028 0 View
I want to use the primer Fw_ITS1 (5'- AGGAGAAGTCGTAACAAGGT -3') to amplify algae but I don't seem to find the original paper of this primer. I can find it in most articles referred to White et...
27 December 2022 9,677 2 View