I want to prepare mobile phase has to be adjusted to pH 4.5 with o.035M phosphate buffer
Can anyone help me to prepare phosphate buffer solution of 0,035M using pH of 4.5 ?
waiting for your favorable response,
thanks
Burcu Uner Though, I don't know what exactly you are aiming at, I think it would be better to use a sodium citrate buffer or an sodium acetate buffer at pH 4.5 because the buffering capacity of Phosphate buffer is best between pH 6 and 7.5
I'm using panc02 cells, mouse pancreatic cancer cell line.Beforehand, I had some issues without doing any fixation, so now I’m trying with fixed cells.
08 August 2023 9,572 1 View
I am working with PEN membrane slides used in laser capture microdissection. When I try to cut the cells on the membrane, too many bubbles are seen. I made a tiny hole on the edge of the membrane...
31 May 2023 9,249 3 View
In our study, 3 different conditions and control tasks of each conditions will be evaluated. Therefore, the duration of the experiment may slightly exceed the time required for a suitable fMRI...
24 October 2021 4,309 3 View
Which medium should I use for this experiment? it should contain no phenol red.
21 October 2021 5,545 3 View
Hello! I need to identify some microorganisms we isolate from nature. The company we have an agreement says that I need to design a primer as fw primer: 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT –...
21 June 2021 8,395 2 View
I have a problem regarding the WSS conversion from OpenFOAM to Fluent. Actually, I can obtain WSS results in OpenFOAM but when I convert the results to Fluent, then WSS values are seen to be zero,...
05 May 2021 3,685 3 View
xdata1=tempmeasS2.Timesec; ydata1=tempmeasS2.UCNP; plot (xdata1,ydata1) err2 = tempmeasS2.UCNP1; e2=errorbar(xdata1,ydata1,err2, 'b-', 'lineWidth', 1, 'HandleVisibility', 'on') legend ('1...
13 January 2021 3,335 3 View
I want to prepare mobile phase has to be adjusted to pH 4 with o.03M phosphate buffer Can anyone help me to prepare phosphate buffer solution of 0,03M using pH of 4 ? waiting for your favorable...
18 November 2020 344 3 View
Hello I want to ask about particle size reducing, İ am working on SLN , while i prepare SLN uses "hot homogenization and hot prob sonication technique" but my particle size does not go below 200...
18 November 2020 6,573 0 View
I found papers cited Englyst et al. (1992) and mentioned Megazyme kit, But unfortunately these were not clear and hard to follow. Thanks in advance,
23 September 2020 1,632 5 View
Does anyone tried to do nucleofection with AMAXA by Lonza with lower than recommended amount of buffer in the cuvettes (100 ul)?
07 August 2024 4,616 0 View
Currently, when I run SDS-PAGE, I don't see any bands at all, even though I used the same material just a day ago and it worked fine.... In our lab, we dilute the 10X running buffer to 1X and...
06 August 2024 5,373 2 View
Hello, I suspect that a molecule I am using is causing bacteria to experience osmotic shock. What chemical properties should I look for to compare this capability with those of other substances?...
06 August 2024 977 1 View
Hello everyone, I'm encountering an issue with my electrochemical impedance spectroscopy (EIS) measurements and would appreciate some insights. Experimental Setup: Electrodes: Gold interdigitated...
05 August 2024 3,783 2 View
Is it the "elution buffer" or the "dialysis buffer"? Note: I'll be using NanoDrop OneC
01 August 2024 967 3 View
We are working on biopolymeric hydrogels. Our system is highly viscous and sticky, and the gel formed are high in strength. We are unable to use pH electrode and pH strip. Please suggest an easy...
30 July 2024 942 2 View
Hello everyone! How can i prepare EDTA buffer solution (pH 8.2) to determine GSH levels? Thank you in advance.
29 July 2024 4,374 1 View
I want to preserve the sample leaves for the LM study of the stomata and conidia analysis. Whether 2.5% glutaraldehyde in 0.05 M phosphate buffer with pH 7 can be applied for preservation.
29 July 2024 8,560 0 View
// interested in the difference between floating events and short circuits.
22 July 2024 6,565 0 View
Our lab has extracted bacterial DNA samples using Qiagen DNeasy kit and eluted the samples in AE buffer. However, this buffer contains 0.5mM EDTA not suitable for downstream application. Any ideas...
13 July 2024 1,675 3 View