24 September 2020 5 2K Report

I found papers cited Englyst et al. (1992) and mentioned Megazyme kit, But unfortunately these were not clear and hard to follow.

Thanks in advance,

More Burcu Guldiken's questions See All
While doing acridine orange ethidium bromide staining for pancreatic cancer cells, is using fixative like %4 paraformaldehyde is valid?

I'm using panc02 cells, mouse pancreatic cancer cell line.Beforehand, I had some issues without doing any fixation, so now I’m trying with fixed cells.

08 August 2023 9,572 1 View

What could be the reason for water trace between the membrane and PEN slides during laser capture?

I am working with PEN membrane slides used in laser capture microdissection. When I try to cut the cells on the membrane, too many bubbles are seen. I made a tiny hole on the edge of the membrane...

31 May 2023 9,249 3 View

What should be the minimum variable inter-trial interval (ITI) durations in event-related fMRI?

In our study, 3 different conditions and control tasks of each conditions will be evaluated. Therefore, the duration of the experiment may slightly exceed the time required for a suitable fMRI...

24 October 2021 4,309 3 View

Use of the medium in the formation of a hydrogen peroxide-induced senescence model in human fibroblast cells?

Which medium should I use for this experiment? it should contain no phenol red.

21 October 2021 5,545 3 View

How to design a primer for identification?

Hello! I need to identify some microorganisms we isolate from nature. The company we have an agreement says that I need to design a primer as fw primer: 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT –...

21 June 2021 8,395 2 View

How can I handle my problem in conversion of OpenFOAM wall shear stress data to Fluent (foamToFluent)?

I have a problem regarding the WSS conversion from OpenFOAM to Fluent. Actually, I can obtain WSS results in OpenFOAM but when I convert the results to Fluent, then WSS values are seen to be zero,...

05 May 2021 3,685 3 View

How can i remove the error bar from the legend?

xdata1=tempmeasS2.Timesec; ydata1=tempmeasS2.UCNP; plot (xdata1,ydata1) err2 = tempmeasS2.UCNP1; e2=errorbar(xdata1,ydata1,err2, 'b-', 'lineWidth', 1, 'HandleVisibility', 'on') legend ('1...

13 January 2021 3,335 3 View

How to prepare 0.03M phosphate buffer pH:4.0?

I want to prepare mobile phase has to be adjusted to pH 4 with o.03M phosphate buffer Can anyone help me to prepare phosphate buffer solution of 0,03M using pH of 4 ? waiting for your favorable...

18 November 2020 344 3 View

How can i reduce my particle size for SLN (my lipid is cethylstearyl alcohol)?

Hello I want to ask about particle size reducing, İ am working on SLN , while i prepare SLN uses "hot homogenization and hot prob sonication technique" but my particle size does not go below 200...

18 November 2020 6,572 0 View

How to prepare 0.035M phosphate buffer pH:4.5?

I want to prepare mobile phase has to be adjusted to pH 4.5 with o.035M phosphate buffer Can anyone help me to prepare phosphate buffer solution of 0,035M using pH of 4.5 ? waiting for your...

18 November 2020 3,529 1 View

Similar questions and discussions
Can formaldehyd-fixed gelatin be melt?

I am puzzled about the properties of gelatin, when used for tissue-embedding. Hard gelatin can be melt again by temperatures about 40°C. Formalin-fixed gelatin is like crosslinked protein and...

07 August 2024 1,685 1 View

Why am I getting "shark finn"-like signal?

My collegue and I are having hard time to understand what is happening. Basically we have a tapping device that work with Arduino and a pneumatic pump. The pump allows the tapping of two...

04 August 2024 4,661 1 View

I need the datasets of Microgrid for system identification?

Hi I am working on data driven model of the microgrid, for that, i need the reliable datasets for the identification of MG data driven Model. Thanks

02 August 2024 5,747 4 View

Should I remove an item from a scale to raise Cronbach's alpha and McDonald's omega or is it better to leave it if they are both over .7 already?

Hello! I have this scale which had 10 items initially. I had to remove items 8 and 10 because they correlated negatively with the scale, and then I removed item 9 because Cronbach's alpha and...

01 August 2024 4,604 7 View

In SEM, if a latent variable consists of three observed variables, and each observed variable has four items, what should I do?

Suppose I am studying the construct of "Academic Motivation" (latent variable) in students, which is measured through three observed variables: "Intrinsic Motivation," "Extrinsic Motivation," and...

31 July 2024 3,911 6 View

Request for Advice: Starch Metabolism Research Project?

I am currently considering a research project focusing on a comparative analysis of starch metabolism in orchids and roses. I am particularly interested in identifying the types and quantities of...

30 July 2024 4,266 2 View

I need a reliable source or an example supported by excel sheet to understand Fuzzy Vikor?

I need a reliable source or an example supported by excel sheet to understand Fuzzy Vikor?

27 July 2024 5,916 1 View

Is a reliability test necessary in my survey on translations?

Dear all, I gave 116 respondents 18 translated sentences and asked them to indicate their levels of acceptance of these translations on a five-point scale. Some translations result from strategies...

24 July 2024 8,245 5 View

Mechanochemistry: ball to powder mass or ball to powder volume?

I run mechanochemical reactions that involves the use of a large amount of catalyst (1:1 molar ratio to the reactant). When I try to understand the effect of amount of catalyst on the reaction, I...

23 July 2024 9,937 1 View

Can you suggest reliable procedures to get displacements from accelerations in frequency domain ?

I have identified many solutions. I need suggestion from somebody with application experience of this topic to identify the most reliable and robust procedure.

21 July 2024 3,465 5 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close