Hello!
I need to identify some microorganisms we isolate from nature. The company we have an agreement says that I need to design a primer as
- fw primer: 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT – [your gene-specific primer]
- re primer: 5′ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT – [your gene-specific primer]
and do the first PCR with these primers before sending the DNA samples.
I will use this for yeast-fungi identification but I am confused. Should I add ITS1 / ITS4 at the end of their primers? Also, are there any primers that are better for fungi than ITS1 / ITS4?
Possibly as these sequences needed by the company are identical in the 19 bases at the 3'end they are using the 5' sequences to bind a common sequencing primer so that all sequences from everyone will sequence with the same 2 sequencing primers and the 3' end is a barcode sequence to define which project the samples come from especially if they are using pyrosequencing as the sequencing method Dirk Schmidt
. My lab used t3 and sp6 sequences sometimes on the end of all specific primers on some projects just to make the sequencing easier and also to get sequence near to the ends of the amplimer if using Sanger sequencing.
AS it appears these are Multiplexing Read Sequencing Primers, have a look at this(Illumina Adapter Sequences) and search your primers seq inside the paper, you will find something which may help you:
https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=&ved=2ahUKEwiV-427qazxAhVIyKQKHde0C5oQFjAAegQIAxAD&url=https%3A%2F%2Fdnatech.genomecenter.ucdavis.edu%2Fwp-content%2Fuploads%2F2013%2F06%2Fillumina-adapter-sequences_1000000002694-00.pdf&usg=AOvVaw0pztbGZb1YCo1QYff_lKAE
- Badges
- Science method