PCR, Cloning, Restriction Digestion, Ligation, Transformation, Plasmid et al | Contact experts in Molecular Biology to get answers
5,550 views 3,365 posts
Questions related to Molecular Biology
Hello everyone, I am isolating PBMCs and stimulating them using different stimulation conditions. my question is, I want to add IL-2 to the medium for better viability after stimulation, Would you...
17 June 2024 1,151 1 View
Gostaria de saber se alguém teria este livro em pdf, o DOI ao qual tive acesso não gerou resultados.
12 June 2024 4,252 0 View
The primers size
30 May 2024 1,032 1 View
If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...
23 May 2024 7,865 1 View
Hi, I am trying to express Trypanothione synthetase a protein from Leishmania, cloned in pET28a vector and transformed in E.coli. BL21 (DE3). The size of the protein is 74kDa. Initially, I...
22 May 2024 4,949 5 View
The RH blood group system is encoded by RHD and RHCE genes, and the difference of G>C at the 676 base of exon 5 of RHCE gene represents the RHE and RHe alleles. If you want to design primers...
22 May 2024 7,865 1 View
I have been trying to get my PCR to work and amplify the correct region but can not figure out what is going on with it. I seemed to have nailed it down to something with the primers. One of the...
20 May 2024 5,304 5 View
Hi All, Our group is doing some flow cytometry assays using an HLA-A*0201 tetramer presenting an HBV peptide (FLLTRILTI) and we're getting some strange results... We ran tetramer flow on a bunch...
17 May 2024 8,382 1 View
My study is about assaying ACTH receptor (ACTHR/melanocortin-2R)distribution in the adrenal cortex of sheep. After extensive search of primary antibody catalogues, I could not find anyone stated...
16 May 2024 6,816 4 View
I did BLAST of the two cellulolytic species and one lignolytic species of bacteria after 16S amplification using PCR. However, my results indicate that the lignolytic organism is 100% similar to...
16 May 2024 4,686 8 View
Hello, I am making some plasmid constructs via Inverse PCR and T4 enzyme ligation. I started with a plasmid that housed nucleotide sequences for two fused proteins. My goal was to cut out the...
15 May 2024 3,445 3 View
I'm performing an antibody phage display with a VHH library and I consistently get frameshift mutants (mainly frame +2) after biopanning. I'm using TG-1 cells for amplification of phagemids and...
15 May 2024 689 2 View
Hello all, I want to immortalize human adult fibroblasts with a lentivirus plasmid containing hTERT under the promoter EF1A and puromycin resistance under the promotor mPGK. I performed a...
15 May 2024 7,083 3 View
The last couple of months I've been trying to replicate a small part of the DNA by using PCR. While everything was working great at first the PCR just stopped working one day. I haven't changed...
14 May 2024 3,024 3 View
Hello everyone. I have an issue with Western blot background when I use a higher percentage polyacrylamide gel during electrophoresis. The very same samples loaded into 10% gel lead to a very...
14 May 2024 8,458 4 View
We are
13 May 2024 1,800 1 View
I have loaded mesoporous silica nanoparticles with a drug and attached them to antibodies but after conjugation with antibodies, the nanoparticles loaded with the drug lose their functionality to...
13 May 2024 4,827 1 View
I am checking GFP fluorescence level in heme sensor. 200 ul of sample was loaded in black flat bottom 96 well plate in H1 Synergy machine. Temperature was 30 degree. I am using S. cerevisiae WT...
07 May 2024 5,819 3 View
my gene of interest size is about 4kb. I used hi fidelity taq pol as well as Q5 from NEB but still its happening. my forward primer composed of a 4 adenosine then restriction site followed by 6x...
06 May 2024 4,699 2 View
Is there a convienient way to mark cancer cells that are undergoing mitosis?
06 May 2024 8,276 4 View
The common Tm without Restriction site is 61 degrees and the Tm with Restriction site is 71 degrees. The reaction conditions i followed is 95 degrees 3 mins, 95 degrees 30 secs, Tm (60-68) degrees...
03 May 2024 630 3 View
For an assay I am planning to run I require a glucose-free MEM-alpha medium, I've seen papers where researchers state they use glucose-free MEM-alpha but they do not provide a supplier or catalog...
03 May 2024 4,124 0 View
I`m in project about miRNA in function, mutations, process and other for explain in a class. And I`m a autism, I have difficult to understand if the peoples the class understanding my class. So, I...
02 May 2024 2,722 0 View
I am trying to optimize sonication for ChIP of AML cell lines viz. HL60 U937 THP1. I am fixing cells with formaldehyde and sonicating 2.5 million cells at a time. If anyone has worked with these...
01 May 2024 7,793 0 View