Why does the number of exons of PTPRQ change by zooming out in Genome Browser site?
the NM number is: NM_001145026.2
difficult to understand since exons numbers are fixed by gene and transcript. maybe you didn't visualize the whole gene (chr12:80,838,015-81,074,052 in hg19), that's all I can see.
fred
This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.
08 August 2024 3,746 4 View
Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...
06 June 2024 448 4 View
I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...
19 May 2024 1,483 2 View
Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...
22 April 2024 6,796 4 View
I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...
06 April 2024 3,951 4 View
Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?
22 March 2024 7,758 0 View
Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?
05 March 2024 7,935 1 View
Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...
24 February 2024 1,806 2 View
I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...
13 February 2024 4,182 0 View
Hi everyone im trying to evaporate gold with electron beam evaporation. but haven't shown any adhesion. i have used microscope slides as well as Titanium as a adhesion layer but there haven't...
06 November 2023 333 1 View
TEP presentation caption (The Environmental Project) Re: Why should Washington’s DC, or any country government point of location think of as nowadays of as to being 'tomorrow as to come! if it...
03 August 2024 2,484 1 View
Given that the bacterial genome has over 800 contigs, but its quality metrics are good, with a completeness of 98.55% and a contamination of 0.68% as assessed by CheckM, what specific validation...
01 August 2024 1,514 1 View
Hello everyone, I am currently looking for tools to recovery viral genomes from bacterial genomes, not metagenomes. However, I have only found tools that are designed for retrieving and studying...
28 July 2024 8,953 1 View
Hi Everyone, I'm using an siRNA kit to knock down a target gene. The kit guarantees that the negative control doesn't target any sequence in mouse genome, and when I use BLAST I don't find any...
23 July 2024 2,673 6 View
I have been trying to extract genome from NCBI using their dataset tool, however some examples seem not to work : ./datasets download genome taxon "Homo Sapiens" --annotated --assembly-level...
20 July 2024 1,339 2 View
Hello researchers, I have sequenced the A549 cell line using RNA sequencing approach and then I have it against the human genome reference sequence. Would I expect a 100% mapping percent? I got...
20 July 2024 9,705 0 View
Hello all, I extracted RNA from my samples and performed RIP-seq. After annotating the genomic regions using R, I obtained promoters, exons, introns, and UTRs. Given that my samples consist of...
18 July 2024 1,579 2 View
We are in need of primers for a PCR protocol for chicken genome. We are looking at the COI barcode, 648-bp fragment of the 5' end of COI. Specifically Primers FalcFA, BirdR1, CO1_ExtF,...
16 July 2024 118 2 View
I have attempted various methods, including homozygous gene disruption and CRISPR-Cas9, but have not achieved the desired results. It appears that the gene of interest is situated in a...
15 July 2024 3,977 1 View
is there any ways that i can find genome similarity of an organism without whole genome sequencing ,like using maths formulas or experimental progress ?
05 July 2024 4,070 3 View