That result seems consistant with the 2013 version 38 genome so You should check the input sequences carefully. Sometimes published primers will have errors. Possibly download your template and match it to the primers by eye

Hi Faterne, Hi Paul,

doing some in silicon PCR, I prefer using the hg19 genome as reference. just take care of the target, if it's not genome assembly, try the UCSC genes and also flip reverse primers if needed.

all the best

fred

>uc001sze.2__PTPRQ:3194+3418 225bp CAGATGAGTCAGTGCCGTTAG AGTAGGTGCTGACTGGTTCC CAGATGAGTCAGTGCCGTTAGcacctccacaaaatttgactttaatcaac tgtacttcagactttgtatggctgaaatggagcccaagtcctcttccagg tggtattgttaaagtatatagttttaaaattcatgaacatgaaactgaca ctatatattataagaatatatcaggatttaaaactgaagccaaacttgtt ggactGGAACCAGTCAGCACCTACT

with hg19 reference and UCSC genes without flipping the reverse primer

fred

I design primers on a Daily basis, for sanger confirmations of pathogenic variants.

I always do in silico pcr at UCSC, and sometimes I got the same messages... sometimes I re-desing primers but not always can you make better primers due to intronic regions with almost no C´s or G`s, so sometimes I purchase the primers anyways and they ABSOLUTELY work.

don`t trust in silico PCR's at 100%, they`re not infallible.