06 March 2024 1 8K Report

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

More Fateme Akhondfeyz's questions See All
Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,744 4 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,950 4 View

What is the role of surface tuxture in anti gravel coatings?

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

22 March 2024 7,757 0 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

How can i evaporate adhesive Gold with electron beam evaporation?

Hi everyone im trying to evaporate gold with electron beam evaporation. but haven't shown any adhesion. i have used microscope slides as well as Titanium as a adhesion layer but there haven't...

06 November 2023 332 1 View

Similar questions and discussions
How do I replace a file with a more recent version of a paper that was uploaded to ResearchGate?

The paper in question is "Interpolation of Nitrogen Fertilizer Use in Canada from Fertilizer Use Surveys". This paper was very recently published by Agronomy (MDPI). Agronomy has, in the last day...

07 August 2024 9,933 3 View

How to solve g_mmpbsa error?

Program: g_mmpbsa, version 2024.1 Source file: extrn_apbs.cxx (line 152) Fatal error: Failed to execute command: $APBS pybYcUWA.in --output-file=pybYcUW.out

07 August 2024 6,065 0 View

How do you delete a duplicate pdf for the same paper on ResearchGate?

The first pdf file I uploaded had an error. So I uploaded an updated, corrected pdf of that paper with a different pdf name. I dpon't want the old copy to be download or read.

07 August 2024 9,506 1 View

AUX gas reading problem on QE with full MS and PRM method in one run?

Dear QE-users, In the method where full MS positive mode and PRM mode are used, we always get an incorrect auxiliary gas reading (41 instead of 25). This only happens in this method; other...

06 August 2024 4,952 0 View

How to Add Missing Water Molecules in Protein-Membrane Simulations?

I have protein-membrane simulations (PDB, PSF, DCD) and have noticed that water molecules near the protein are not visible in the simulations. How can I fix this issue? Is there a way to place the...

04 August 2024 1,200 2 View

JCPDS 65-7246 file please?

Dear Researchers Kindly share JCPDS 65-7246 file Thanks in advance

04 August 2024 5,612 1 View

Dirty and clean?

Hi everyone I need a file with a dirty and clean potato image

04 August 2024 7,198 4 View

How to change the version of the article full-text pdf file?

How to change the displayed full article text to its corrected version? In the file on the page of the journal where I published the article, there was an error in the text, the table is...

30 July 2024 3,229 2 View

How to do pca analysis of c-alpha atom of the protein?

i m interested in pca analysis of c-alpha atoms in gromacs for that i used the following gmx_mpi covar -s mdca.tpr -f mdca.xtc -o eigenvalca.xvg -v eigenvecca.trr -av average.pdb -n index.ndx but...

30 July 2024 1,604 1 View

Difficulty with permittivitt and Magnetic Permeability Calculations?

Difficulty with permittivitt and Magnetic Permeability Calculations Hello everyone, I have all the parameters related to the calculations of the permittivitty and magnetic permeability...

30 July 2024 5,206 1 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close