What is the role of surface tuxture in anti gravel coatings?

23 March 2024 0 8K Report

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

More Fateme Irani's questions See All

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,744 4 View

In a multi-scale calculation using ORCA, are charges of the QM system updated during each iteration of optimization?

I'm performing multiscale calculations with mechanical embedding in ORCA and I have a question about how atomic charges are handled during geometry optimization and reaction coordinate scans. Are...

06 July 2024 1,360 0 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

Have you ever run a steered molecular dynamic simulation with NAMD?

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

05 March 2024 7,935 1 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

Adhesion strength of coating?

How can I determine a good adhesion strength range for coatings on polymer surfaces, such as DLC on polymer substrates? Is there a specific threshold for adhesion strength (from T-peel tests)...

10 August 2024 940 3 View

How do I conformally do PR spin coating on trench structure?

I did PR spin coating on trench structure. I used AZ P4620 PR and the thickness or PR is around 11um. The substrate is Si. And my trench structure depth is 141um(negative way). Even though I...

08 August 2024 2,297 0 View

Why do i have a weak plasma and no coating during rf sputtering?

I have been getting a low plasma and no coating while doing rf sputtering of copper doped ZnS using a power of 140 watts and at pressure of 6.5x10-3 Mb.

07 August 2024 4,524 4 View

What is the reason I get 400nm nanoparticles using an extruder with 200 nm membrane for cell membrane coating?

I am trying to coat my micelles and PLGA based nanoparticles with cell membrane using an Avanti mini extruder according to literature . I use 200nm membrane but my particles end up to be 400nm And...

30 July 2024 3,291 3 View

What is the main used curing agent for epoxy based coating?

I am trying to coating metal oxide into steel substrate, for better sticking planning to utilse epoxy based, Could you please suggest suitable curing agent for the coating purpose

25 July 2024 438 3 View

How do you get pure primary macrophage cell culture?

I have been harvesting monocyte-derived macrophages from buffalo and cattle fresh whole blood using the same protocol for years and getting good macrophage cultures. Below is the protocol that I...

23 July 2024 4,073 2 View

Issues in coating of cathode material on Al foil, why we are not getting proper coating and results when the cathode was coated on Al-foil..?

We are trying to coat some cathode materials on Al-foil ( ex - LiFePO4 , S@CNT, etc). When we coated the Al foil with the cathode (ex - S@CNT) material , the cycling result was annoying. But the...

09 July 2024 5,122 4 View

Why NCM cathode slurry has coating problem?

I tried to make slurry for NCM cathode but there was problem in coating process. The detail of my experiment is following; The ratio between active material(NCM811), conductive additives(Super-P)...

08 July 2024 7,327 4 View

Why can't we get on top of this incubator infection (fungal)?

We have been experiencing repeated what looks very much like fungal contaminations in several incubators (in the same lab). We have tried the following repeated times and yet the coating on all...

02 July 2024 6,374 2 View

How to load Remedesivir drug into mesoporous nanoparticles?

Hello, I want to load Remedesivir (RNA polymerase inhibitor) into mesoporous nanoparticles (MSNs). The issue is drug is temperature and pH sensitive and it degrades quickly. I need advice on its...

01 July 2024 889 3 View