Fateme Komshikamar

2 Questions 1 Answers 0 Followers

Questions related from Fateme Komshikamar

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

22 April 2024 8,278 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

07 April 2024 3,931 4 View