2 Questions 1 Answers 0 Followers
Questions related from Fateme Komshikamar
Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2
22 April 2024 8,421 1 View
I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...
07 April 2024 4,021 4 View