I want to have a pair of primers for any gene or region 1.5-3.5 kb range so that I can use them as a positive control for yeast colony PCR (To test if my colony PCR is working) besides while testing transformation positive colonies? Anyone has tested pair of primers which I can use?
I am cloning an insert into a plasmid that I then transform in bacteria. For colony PCR my primers amplify ~150 bp if there is no insert. If the band is larger by the expected amount the insert is there; if there is no band then I know that PCR didn't work. I do not know if you are able to design your experiment like this because I do not know what you are trying to accomplish. However, any primers that have been shown to work in the past can be used as a control. Usually you will want the control primers to amplify a segment that is the same size as the experimental fragment and if it is not working it is nice to have primers that will amplify a smaller and and ones that amplify a larger band to see if it's the cycle settings.
The question is a bit vague. Why not make primers that amplify the WT gene and a set that amplifies the modified gene? What is your protocol for yeast colony PCR? Cheers, Evelyn
Hi,
What species of yeast do you use (Pichia pastoris or Saccharomyces cerevisiae)? In general, yeast colony PCR is similar to bacterial colony PCR. If you transform a gene into the yeast, just do PCR with a primer pair which is specific for your gene.
If you want to test whether yeast colony PCR is working or not, you can try the primer pair for ITS of rDNA:
ITS1: TCCGTAGGTGAACCTGCGG
ITS4: TCCTCCGCTTATTGATATGC
This primer pair should work for yeasts!
Hope it helps.
Tuan Tran
Hi Diven,
These primers work for both yeasts and molds.
Good luck to you.
Tuan
Of course, they definitely work for Saccharomyces cerevisiae with the PCR product of ~900 bp.
Best.
- Badges
- Science method