Hello every body. i have problem in my work on PCR product , when i done PCR by using primers for one gene has 460bp product, i get multiple bands more than 4 bands. but i know use the correct pcr thermocycler condition such as 95C for 5 min (Intial dent.), 95C for 1 min (dent.), 55C for 1 min (annealing), 72C for 1 min (extenting) and 72C for 7 min (Final ext.), and my primers F:GCTGTAAACGAACTCGCCC, R:ATCCGCTATTTACCCAGTGG
are you any one have resoultion to my probems
Thanks