This is a common need in biochemistry labs—having a source of high-quality, tag-less GST for controls, antibody production, or biochemical assays. You are absolutely correct that standard GST fusion vectors (like pGEX) are optimized for expressing the fusion partner and often express GST poorly when the cloning site is empty due to issues with translation initiation and mRNA stability.

Here are the most reliable strategies to get high-yield expression of standalone GST, from the simplest to the most custom.

Strategy 1: The Clever Use of a Standard pGEX Vector

This is the most straightforward approach if you already have a pGEX vector.

· Principle: Don't leave the Multiple Cloning Site (MCS) empty. Clone a short, stable, and easily cleavable peptide sequence into it.

· Method: Synthesize two complementary oligonucleotides that, when annealed, form a short double-stranded DNA fragment. This fragment should contain:

1. Your desired restriction sites for cloning into the pGEX MCS (e.g., BamHI and XhoI).

2. A short coding sequence (e.g., 6-15 amino acids).

3. Crucially, include a stop codon right after this short sequence.

· Result: You now have a pGEX vector expressing "GST-[Short Peptide]". Because there is a genuine open reading frame, it will express very well.

· Downstream Processing: You have two options:

1. Purify the fusion protein and use it as-is. For many control experiments (e.g., validating an ELISA or a pull-down), the short peptide will not interfere, and this is the easiest path.

2. Cleave with PreScission Protease (or Thrombin/TEV). Since the pGEX vector has a protease site between GST and the MCS, you can cleave off the short peptide. After cleavage, you can pass the mixture back over a glutathione column. GST will bind, and the short peptide will flow through, giving you pure, standalone GST.

This effectively recreates the "GST vector that had a short peptide" that your old lab had.

Strategy 2: Use a Specialized Vector Designed for Tag-Only Expression

Some vectors are explicitly designed for this purpose. They contain a strong, optimized ribosome binding site (RBS) directly upstream of the tag, followed by a protease site and a stop codon.

· Example: Addgene #136052 (pGST-1)

· This is a derivative of the pGEX-6P-1 vector that has been modified to express GST alone. It places a strong T7 promoter and an optimized RBS directly in front of the GST sequence, followed by the PreScission protease site and a stop codon. This construct is proven to express soluble GST at very high levels.

Strategy 3: Clone the GST Sequence as a Standalone Gene

This gives you the most control and is the most "pure" solution.

Step 1: Get the GST DNA Sequence

The GST in pGEX vectors is typically Schistosoma japonicum Glutathione S-transferase. You can get its codon-optimized DNA sequence from public databases (like UniProt ID P08515) or directly from the pGEX vector sequence (e.g., GenBank accession U13855 for pGEX-2T).

Here is a canonical coding sequence for the 26 kDa GST tag (commonly used in pGEX vectors), provided in FASTA format. You can have this synthesized as a gBlock or amplify it from an existing pGEX plasmid.

Note: This is an example sequence. Always verify it against your specific vector version.

...

ATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTAAAAACACATCTGTAGACCCTGAAGTTAAGAAAAT

```

Step 2: Choose an Expression Vector

Clone this sequence into a standard T7 or T5 promoter-based expression vector (like pET, pQE, or pJExpress series) that lacks an N-terminal tag. The key is to ensure the vector provides:

· A strong promoter (T7 is excellent for E. coli).

· A strong Ribosome Binding Site (RBS).

· A start codon (ATG) directly before your GST sequence.

· A stop codon immediately after your GST sequence.

Recommended Vector: A pET vector (e.g., pET-21a, pET-28a) where you clone the GST sequence directly into the MCS without leveraging the His-tag. The strong T7 promoter will drive very high expression.

Summary and Recommendation

Method Effort Required Yield Recommendation

1. pGEX with Short Peptide Low (Quick cloning) High Best starting point. Fast, reliable, and leverages existing lab resources.

2. Specialized Vector (e.g., pGST-1) Very Low (Just transform) High Excellent if you can get the plasmid. The most direct solution.

3. Clone Standalone GST High (Synthesis/Cloning) Very High Most flexible and pure solution for the long term if you plan to use GST frequently.

For your immediate needs, Strategy 1 (modifying a pGEX vector) is highly likely to replicate the success you remember from your old lab. Designing and cloning a short peptide insert is a simple and cost-effective weekend project that will yield a robust expression system.