Yeast identification?

More Nadeem Elhussieny's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

QSPR model is not fit for or it does not deliberate best answers. How we can improve it?

The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.

29 August 2023 7,764 2 View

What the difference exists between the QSPR analysis by using 2D and 3D model of drugs structures?

Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?

27 August 2023 552 2 View

How to establish a Mathematical Model on "Transfer of heat in human body organs"?

I'm looking for a mathematical model for transfer of heat in human body organs especially (eye, heart, brain and lungs). How is the behavior of heat transfer at normal and extreme levels

12 July 2023 4,888 2 View

How much Yeast should we add to fermentation media?

I have prepared a liquid broth containing Yeast (S. Cerevisiae) that i need to add from it to fermentation media of lignocellulosic hydrolysate. I need to know based on what parameters do we add...

06 August 2024 662 1 View

Does anyone have issues using Prepman Ultra reagent for MicroSeq ID bacterial, fungal and yeast sample preparation?

I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...

01 August 2024 2,079 0 View

Solvent recovery after extraction - Separation of Isopropanol + Water - how to do it best?

I want to make some yeast extractions with a protocol that uses Isopropanol and NaOH. So in the end i will have an azeotrope of Isopropanol and Water that comes from the cell and NaOH. Can you...

08 July 2024 9,201 2 View

Why my yeast colony PCR gel has one specific band , but the size is incorrect even when the plasmid DNA that is originally transformed is correct?

The plasmid that was transformed originally is correct (sequenced). I am expressing different gene targets from the yeast genome to optimize my protein. When I sequence the incorrect size, it...

01 July 2024 2,356 6 View

What are these small structures found when PBMC cells are isolated?

Image attached is at 20X. Cultured media for checking presence of bacteria and yeast and both tests were negative.

27 June 2024 7,473 4 View

Is it legally permissible to reuse algae biomass following the treatment of non-hazardous laboratory waste?

Hello, community, Could you please clarify whether current legislation permits the reuse of algae biomass after it has been used to treat non-hazardous decontaminated laboratory organic waste?...

05 June 2024 5,040 1 View

Yeast carbon base (YCB) + agar + BSA?

I'm planning to perform BSA degradation using YCB and agar, but I need a protocol. Does anyone have one they'd be willing to share?

02 June 2024 6,885 8 View

How can we extract DNA from yeast isolates without using any lysis buffer or lysis enzymes? Is there any manual protocol?

31 May 2024 548 4 View

How much glucose to add to LB media to prevent leaky expression?

I am already using BL21(DE3)pLysS cells but I am still getting leaky expression in pre-expression samples before IPTG is added. LB broth is tryptone, salt and yeast. Thanks :)

28 May 2024 2,820 2 View

Can instant dry yeast provides calcium and nitrogen ?

Is the instant dry yeast, or Brewer's yeast, Saccharomyces cerevisiae, had the ability to provide calcium and nitrogen minerals in addition to ethahnol ? Please support answers with published...

28 May 2024 1,073 4 View

Naveen Reddy

hi Nadeem u can identify yeast through sugar fermentation tests. give me ur mail id i will get u identification protocol.

i hope it will be helpful.

Mrs. Parveen Surain

Tell me your source of isolation first

Sudipta Mandal

If you want to identify upto Genus or species level then Sequencing is the best and latest method.

Andrey M Yurkov

You cannot identify yeast species by performing tests for nitrogen assimilation only.

Indeed, sequencing ITS or LSU rRNA (e.g. commercially) would be the easiest option.